D. Asteroids vary greatly in size and are mostly made up stone, iron and nickel
False. They form a V formation so that it will lower their heart rate and make it easier to go longer distances. And when they are in a V formation, it results in wind resistance.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Asexual reproduction or mitosis. Hope this helps, and if it does, plz mark me as brainiest! Have a beautiful day/night! ^-^
