1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melisa1 [442]
3 years ago
8

discuss the meaning of the following statement:"The job -seeking process is just like a job itself ".Include suggestions for con

ducting a successful job search ​
Biology
1 answer:
svetlana [45]3 years ago
7 0

Answer:

The above statement means that the process of job-seeking requires so much effort that it is like a job itself. You have to be as committed to job- seeking as you will have to be when you actually get a job. The process of job- seeking is tiresome in today's world, especially for people who have a little or no experience at all. You have to be attentive for every new job- opening and work hard to submit your resumes, forms etc. The, you have to work hard for the interviews being conducted. The waiting process also takes a lot of time and patience. Hence, the process of job-seeking is just like a job itself.

You might be interested in
What part of the brain controls breathing and heart rate apex?
vladimir2022 [97]
The medulla controls breathing and heart rate. hope this helps!
(could you please mark brainliest? Thanks!)
4 0
3 years ago
Read 2 more answers
For any point on earth surface its height above sea level is call
Elis [28]
The answer should be altitude
6 0
4 years ago
Chemicals from sea slugs may be useful in:
Verdich [7]
Chemicals from sea slugs may be useful in <span>sewage treatment plants.
</span>The sewage treatment plants process includes <span> removing contaminants from wastewater, primarily from household sewage. </span>
The output of the sewage treatment process is treated wastewater that is safer for the environment.
4 0
3 years ago
Read 2 more answers
Compared the Mendelian Dominance, how to incomplete dominance and codominance increase the number of phenotypes? Provide an exam
REY [17]

Answer/Explanation:

<h3>Incomplete dominance</h3>

In incomplete dominance, one allele is not entirely dominant over the other, so heterozygotes (organisms with two different alleles for the gene) show an intermediate or blended phenotype.

For example, consider flower colour.

  • If the allele for red flowers (R) was dominant over the allele for white flowers (r), then there are three possible genotypes (RR, Rr, and rr) and two possible phenotypes. (Red (RR and Rr) and white (rr)).
  • However, if the allele for red flowers (R) was incompletely dominant over the allele for white flowers (r), then there are three possible genotypes (RR, Rr, rr), and three possible phenotypes (red (RR), white (rr), and pink (Rr))
<h3>Co-dominance</h3>

In incomplete dominance, two alleles are both expressed, one is not dominant over the other. Therefore, heterozygotes (organisms with two different alleles for the gene) express both traits.

For example, consider flower patterns.

  • If the allele for spots (F) was dominant over the allele for stripes (f), then there are three possible genotypes (FF, Ff, and ff) and two possible phenotypes. (Spots (Ff and ff) and stripes (ff)).
  • However, if the allele for spots (F) was co-dominant to the allele for stripes (f), then there are three possible genotypes (FF, Ff, ff), and three possible phenotypes (spots (FF), stripes (ff), and spots and stripes (Ff))

8 0
3 years ago
What type of plants can reproduce through seeds?​
valentinak56 [21]

Most plants grow from seeds. These seed plants fall into two groups, <u>angiosperms</u> and <u>gymnosperms</u>.

hope this helps ^^

5 0
3 years ago
Other questions:
  • Extinction results in _____.
    11·2 answers
  • What is legnth and width of a human?
    9·2 answers
  • Describe the eye of a hurricane
    6·1 answer
  • Define purebred using both terms genotype and allele.
    5·1 answer
  • What happened to our ozone layer?​
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The traits of the offspring are the
    6·1 answer
  • What turns on and off the lac operon
    11·1 answer
  • In which one of the following points does the induced fit model of enzyme action differ from the lock and key model? *
    9·1 answer
  • PLS HELP!!!! will mark brainlyiest!!!!!!
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!