1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksandrR [38]
4 years ago
8

A family wants to determine how much of the total monthly income is going to various expenditures (food, housing, utilities, etc

.). Which of the following would be most helpful in displaying this data? Note: I am NOT asking how the budget changes over time.
A)
Line Graph


B)
Circle Graph


C)
Bar Graph


D)
Frequency Table
Biology
2 answers:
timurjin [86]4 years ago
8 0
I'm not a hundred percent sure, but I would say bargraph's or circle graphs are definitely the most efficient.
kozerog [31]4 years ago
8 0
Its circle graph. hope this helps, and im pretty sure its right cuz ihave the same question.

You might be interested in
. when preparing to discharge a patient who had an indwelling urinary catheter removed 24 hours ago, the nurse would offer patie
tia_tia [17]

when preparing to discharge a patient who had an indwelling urinary catheter removed 24 hours ago, the nurse would offer patient education regarding  common complication Urinary tract infection.

  • Infection and growth of germs in the urinary tract (the kidneys, ureters, bladder, and urethra). The bladder or urethra is the site of the majority of urinary tract infections. Diabetes, hormonal changes, kidney stones, an enlarged prostate, or a spinal cord injury can all raise the risk of a urinary tract infection. Other risk factors include pelvic radiation therapy or surgery, taking certain medications (such as anticancer drugs), and using a catheter to empty the bladder. Urinary tract infections are very frequent, particularly among women. Also known as UTI.
  • Urinary catheters are flexible tubes that are used to empty the bladder and collect urine in a drainage bag. A doctor or nurse will generally install a urinary catheter.

To learn more about Urinary tract infection.

brainly.com/question/10816484

#SPJ4

7 0
2 years ago
Which of the following is NOT a membrane-disrupting toxin?
Vaselesa [24]

Answer:

Answer is A-B toxin.

Explanation:

A membrane-disrupting toxin is toxin that affect the cell membrane. The effect of its secretion  could be by interrupting the phospholipid layer or through pores formation on the membrane.

Membrane- disrupting toxins are regarded as  exotoxins. Examples are leukocidin and hemolysin which their effects cause leakages of the cytoplasmic content and lysis of the cell, through the formation of pores on the cell membrane.

The A-B toxin are produced by the proteins of pathogenic organisms such as the bacteria. Example is botulinum toxin.

3 0
4 years ago
For current to flow the circuit must be _____
riadik2000 [5.3K]

Answer:

a complete circuit

Explanation:

5 0
4 years ago
In your own words, how does a virus work?
Rina8888 [55]

Explanation:

viruses are very small -- 100 times smaller than the average bacterium, so small that they can't be seen with an ordinary microscope. Viruses can only exert influence by invading a cell, because they're not cellular structures. They lack the ability to replicate on their own, so viruses are merely tiny packets of DNA or RNA genes enfolded in a protein coating, on the hunt for a cell they can dominate.

7 0
4 years ago
Select all that apply The filtration pressure in the glomerulus is determined by the balance of which two pressures
rewona [7]

The filtration pressure in the glomerulus is determined by the balance of two pressures that are colloid osmotic pressure and blood hydrostatic pressure.

A blood test called a glomerular filtration rate (GFR) measures how well your kidneys are functioning. Glomeruli are little filters found in your kidneys.

These filters aid in clearing the blood of waste and extra fluid. How much blood flows through these filters each minute is determined by a GFR test.

Along with the permeability and surface area of the glomerular membrane, it is governed by the equilibrium of blood hydrostatic and colloid osmotic forces across the membrane.

Autoregulation keeps renal blood flow and, consequently, GFR constant between mean arterial blood pressure ranges of 80 and 180 mm Hg.

Learn more about Glomerulus filtration rate here brainly.com/question/13064727

#SPJ4

Note : The question is incomplete and consist of four options

a) Lymphatic

b) Colloid osmotic

c) Blood hydrostatic

d) Venous

4 0
2 years ago
Other questions:
  • In science, confusion sometimes arises because a term used by scientists takes on a special meaning which conflicts with the use
    12·1 answer
  • Which chemical compound produced during photosynthesis is used by plants to store energy
    13·1 answer
  • Which of the following relationships may present harm to one of the organisms involved?
    11·1 answer
  • Which of the following is in the correct order from smallest to largest? a.DNA_genes_chromosomes
    8·1 answer
  • How does an symbiosis differ from a predator-prey relationship?
    13·1 answer
  • 7. What are the two reactions that take place during aerobic respiration and where do they occur?
    13·1 answer
  • which of the following activities is the largest producer of primary air pollutants in the united states? healthcare transportat
    5·2 answers
  • Why is science essential in environmental science
    7·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • How is an
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!