1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katyanochek1 [597]
3 years ago
7

The synaptic effect of cocaine is to __________.

Biology
1 answer:
Sedaia [141]3 years ago
5 0
B. speed up the reuptake of dopamine and norepinephrine

You might be interested in
which of the following is not a characteristic of Arthropods that has attributed to their diversity and success A. endoskeleton
ValentinkaMS [17]
A. endoskeleton

Endoskeleton is not a characteristic of Arthropods that has attributed to their diversity and success. Endoskeleton is defined as inner characteristics of the skeletal feature of an organisms such as bears, humans, fish and etc.

Exoskeleton on the other hand is the trait by which arthropods posses. It is skeletal feature that is described outside or is extrinsic, this is evident as crabs have their skeletons outside of their body.


6 0
2 years ago
Muscle fibers are directly surrounded by which thin layer of connective tissue?
wlad13 [49]

Answer:

The correct answer will be- epimysium

Explanation:

Epimysium is the fibrous connective tissue envelope which surrounds the muscle fibers of the muscle as a whole.

The epimysium plays an important role in maintaining the muscle structure as it protects the muscle from the friction caused by the associated bones and the muscles. The epimysium is continuous with other layers called the endomysium, perimysium, tendons and the fascia.

Thus, epimysium is the correct answers.

 

4 0
3 years ago
What does the immune system protect the body against?
Rudik [331]
The immune system protects your child's body from outside invaders, such as bacteria, viruses, fungi, and toxins (chemicals produced by microbes). It is made up of different organs, cells, and proteins that work together.

Anatomy of the immune system

There are two main parts of the immune system:

The innate immune system, which you are born with.

The adaptive immune system, which you develop when your body is exposed to microbes or chemicals released by microbes.

These two immune systems work together.

The innate immune system

This is your child's rapid response system. It patrols your child’s body and is the first to respond when it finds an invader. The innate immune system is inherited and is active from the moment your child is born. When this system recognizes an invader, it goes into action immediately. The cells of this immune system surround and engulf the invader. The invader is killed inside the immune system cells. These cells are called phagocytes.

The acquired immune system

The acquired immune system, with help from the innate system, produces cells (antibodies) to protect your body from a specific invader. These antibodies are developed by cells called B lymphocytes after the body has been exposed to the invader. The antibodies stay in your child's body. It can take several days for antibodies to develop. But after the first exposure, the immune system will recognize the invader and defend against it. The acquired immune system changes throughout your child's life. Immunizations train your child's immune system to make antibodies to protect him or her from harmful diseases.

The cells of both parts of the immune system are made in various organs of the body, including:

Adenoids. Two glands located at the back of the nasal passage.

Bone marrow. The soft, spongy tissue found in bone cavities.

Lymph nodes. Small organs shaped like beans, which are located throughout the body and connect via the lymphatic vessels.

Lymphatic vessels. A network of channels throughout the body that carries lymphocytes to the lymphoid organs and bloodstream.

Peyer's patches. Lymphoid tissue in the small intestine.

Spleen. A fist-sized organ located in the abdominal cavity.

Thymus. Two lobes that join in front of the trachea behind the breastbone.

Tonsils. Two oval masses in the back of the throat.

How do antibiotics help fight infections?

Antibiotics can be used to help your child's immune system fight infections by bacteria. However, antibiotics don’t work for infections caused by viruses. Antibiotics were developed to kill or disable specific bacteria. That means that an antibiotic that works for a skin infection may not work to cure diarrhea caused by bacteria. Using antibiotics for viral infections or using the wrong antibiotic to treat a bacterial infection can help bacteria become resistant to the antibiotic so it won't work as well in the future. It is important that antibiotics are taken as prescribed and for the right amount of time. If antibiotics are stopped early, the bacteria may develop a resistance to the antibiotics and the infection may come back again.

Note: Most colds and acute bronchitis infections will not respond to antibiotics. You can help decrease the spread of more aggressive bacteria by not asking your child’s healthcare provider for antibiotics in these
4 0
2 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
It’s urgent One word for a,b,c,d,e please I will make you brainliest <br> Only the cut papered ones
Alborosie

Answer:

a-translocation

b- digestion

c- egestion

d- nutrition

e- absorption and assimilation

6 0
2 years ago
Read 2 more answers
Other questions:
  • PLZ ASAP!!!!! ill mark you as brainliest 
    9·1 answer
  • What can a hypothesis become if it is supported by repeated experimentation?
    9·2 answers
  • What protein (purine)-rich food should be limited to prevent a reoccurrence of uric acid kidney stones?
    5·1 answer
  • Jasmine is healthy girl who is playing outside. Her internal body temperature rises to 38°C, which is above normal.
    10·1 answer
  • How are primary and vesicular follicles anatomically different?
    8·1 answer
  • Compare the roles of the phospholipid bilayer in passive and active transport.
    15·1 answer
  • Which of the following are examples of sexual reproduction?
    8·2 answers
  • Which of the following is not a step of Natural Selection?
    14·1 answer
  • During freezing, what is the phase change occurring?
    13·2 answers
  • Which part is hydrophobic?<br><br> Tails<br><br> heads<br><br> legs<br><br> arms
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!