1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zavuch27 [327]
3 years ago
6

Define the rock cycle. Include the process a rock would go through, starting from volcanic eruption. ( in your own words please

) :)
Biology
1 answer:
Elodia [21]3 years ago
5 0
It would be weathered into sediments and then eroded and deposited and then pressure and heat would turn it into a sedimentary rock and then it would melt down into magma again and then it would cool into igneous after erupting again.
You might be interested in
Which of the following are the components of a neuron brain, spinal cord, and vertebral column dendrite, axon, and cell body sen
natali 33 [55]
<span>
Dendrite, axon, and cell body are the major parts of neurons. </span>
3 0
3 years ago
Trawling adversely affects marine life zones because it introduces invasive species into the environment. true false
USPshnik [31]
The correct answer, I believe is false. 
6 0
2 years ago
Read 2 more answers
Which pair of atom an ionic bond
Anna11 [10]
Between a cation, which is usually a metal, and an anion, which is usually a nonmetal. A covalent bond involves a pair of electrons being shared between atoms.
7 0
2 years ago
What species are commonely found in tundra biomes
Aleksandr-060686 [28]
 Plants and Animals are commonly found in Tundra Biomes.
3 0
2 years ago
If you were born with an extra finger, which organic molecule was responsible for this malformation
melamori03 [73]

Answer:

Nucleic acid would be responsible.

Explanation:

6 0
3 years ago
Other questions:
  • Contrast the significance of the cone of increasing diversity
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Plants contain lignified conducting cells.
    13·1 answer
  • Which organism has a central brain <br> a.sponge <br> b. hydra <br> c. flatworm <br> d. fish?
    9·2 answers
  • Triglycerides are composed of glycerol and fatty acid chains..
    5·1 answer
  • An alcohol thermometer makes use of alcohol's changing _______ in order to measure temperature. As the temperature goes up, the
    7·2 answers
  • Which of the following is correct?​
    14·2 answers
  • Pls helps will reward brainliest
    14·1 answer
  • Please help me... The advantages of soaking pineapple slices in a concentrated sugar solution compared to storing fresh pineappl
    5·1 answer
  • Assess whether urban or rural areas are more likely to have high levels of smog.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!