Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
D.
Explanation:
"However, a biopsychosocial approach to treatment is required to address all symptoms, particularly as organic disorders often have affective and relational consequences as well. Psychotherapy and cognitive rehabilitation strategies have been shown to be effective with a variety of acute and chronic organic disorders. Although therapeutic interventions with chronic degenerative conditions, such as Alzheimer’s dementia, cannot produce permanent change, they can optimize the person’s functioning and increase quality of life."-https://link.springer.com/referenceworkentry/10.1007%2F978-0-387-09757-2_36
I hope this helps.
Answer:
50%
Explanation:
According to the given information, the allele for the red-green colorblindness is inherited in an X linked recessive manner. Let's assume that the allele X^c is responsible for red-green colorblindness. The woman is normal but had a colorblind father (X^cY). Fathers give their X chromosomes to the daughters while their Y chromosome is transmitted to their sons. The sons get their X chromosomes from the mother.
The colorblind father has transmitted the X-linked allele for the red-green colorblindness to his daughter. Therefore, the genotype of the woman is X^cX. The woman would produce two types of eggs: 50 % with X^C and 50% with X. Therefore, 50% of sons of this woman would get X linked allele for the red-green colorblindness and would be affected by the disorder while the rest 50% of her sons will be normal.
Answer:
a. Reproduction occurs rapidly
Explanation:
asexual reproduction can occur rapidly, more quickly than sexual reproduction
