1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mrs_skeptik [129]
3 years ago
6

material composed of two or more elements or compounds that are physically mixed together but not chemically combined whats the

answer please?
Biology
1 answer:
wel3 years ago
3 0
A mixture
If the elements or compounds aren't chemically bonded then they are known as a mixture :)
You might be interested in
When dna begins to replicate, two strands of the dna helix are separated, forming a replication bubble. at each end of the bubbl
Alekssandra [29.7K]

During the process of replication, the double stranded DNA unwinds and parts itself by the action of enzyme called as Helicase. The unwinding or separation of DNA forms a replication bubble and at the edge of the replication bubble is the replication fork.

DNA replication starts at the point called as origin of replication or ORI at the replication fork. DNA polymerase is the enzyme that plays a key role in DNA replication. DNA continues to replicate until the entire new strand is not formed.

7 0
3 years ago
What provides the energy that drives the water cycle?
Alenkinab [10]
The sun. The sun provides the energy for evaporation and even for the rest of the water cycle without the sun it wouldn't work. Unless you had a giant heat lamp over the ocean lol
7 0
3 years ago
Explain how the career area of respiratory therapy relates to our study of oxygen and lung volumes. provide an example that illu
fomenos
 It relates perfectly because the experts of respiratory therapy are usually dealing with patients that can’t breathe or are having <span>blockage in their lungs. The exmaple could be in an emergency room where a person cannot breathe and the therapists checks the volume of oxygen in the patient and his lungs to see if there is something blocking the airways</span>
3 0
3 years ago
How would you explain the development of motor skills as well as sensory and perceptual development?
juin [17]

Answer:

Motor skill develop through the interaction of body system specifically sensory, perception and biochemical systems

3 0
3 years ago
How does the digestive system work?
sergij07 [2.7K]
It takes the food you eat, breaks it up into small pieces, and turns it into energy
8 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is the main difference between plants on land and phytoplankton
    11·1 answer
  • Which is an infection of the fluid that surrounds the spine and brain?
    9·2 answers
  • Climate
    15·2 answers
  • How does the nucleus help the cell process waste?
    12·1 answer
  • The main reason that family and friends are frequent targets of aggression is that
    14·2 answers
  • 4. Frozen water is less dense than liquid water, Explain why this is important for aquatic
    12·1 answer
  • Plant fertilizers contain salts. Why is it important to use the correct amount of fertilizer?
    14·1 answer
  • How does Sexual reproduction leads to genetic variation.​
    11·2 answers
  • What are the small air sacs called that exchange gases in the lungs? valves chambers alveoli nodes.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!