1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ryzh [129]
3 years ago
15

A phycologist is interested in testing the claim that the proportion of algae from a local rivulet that belonged to the particul

ar phylum cyanobacteria is at least half. A random sample of 50 alga was obtained and each alga was categorized as either being cyanobacteria or not. It was found that 38 were, in fact, cyanobacteria. The test statistic for this hypothesis test is...
Biology
1 answer:
Shkiper50 [21]3 years ago
4 0

Answer:

The test statistic for this hypothesis test is - 3.68.

Explanation:

A test statistic is a random variable that is calculated from sample data and used in a hypothesis test. You can use test statistics to determine whether to reject the null hypothesis. The test statistic compares your data with what is expected under the null hypothesis.

Sample proportion = 38/50

= 0.76

Hence,

Test statistic

= \frac{0.76-0.50}{\sqrt{0.50*0.50/50}}

= 3.68

You might be interested in
If purple flower color is dominant and red flower color recessive, how many phenotypes are possible in offspring of homozygous p
bekas [8.4K]
The genotype depends if the purple flower is heterozygous dominant of homozygous dominant. But the total possible phenotypes available is 2, purple or red. 

3 0
3 years ago
Determine if the following statement is TRUE or FALSE:
Blizzard [7]

Answer:

False

Explanation:

condensation points is the complete opposite of boiling points. Condensation point is when its is so cold that water goes from a gas to a liquid and boiling points is when water goes from liquid to gas because it is so hot. Hope this help! -3-

6 0
3 years ago
48. Which of the following is an example of a point source of pollution? Agricultural pesticides from crops Oil spill from a tan
vichka [17]

Answer:

Oil spill

Explanation:

Its the oil spill because the pollution from it can be traced back to a specific source

5 0
3 years ago
A situation in which the coefficient of coincidence is greater than 1.0 would indicate that: A. no double crossovers were found
damaskus [11]

Answer:

B. there were more double crossovers in the progeny than would be expected based on probability

Explanation:

Crossing over or recombination can be defined as the exchange of genetic material between homologous chromosomes during meiosis. Moreover, the coefficient of coincidence is the number of double recombinants found in the progeny. The coefficient of coincidence can be estimated by the following equation:  

Coefficient of coincidence  (COC) = ADRF / EDRF

where ADRF = Actual Double Recombinant Frequency

and  EDRF = Expected Double Recombinant Frequency

In the case above described, ADFR is higher than EDRF, and therefore COC will be higher than 1.

3 0
2 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • How much time is needed to form most fossils
    7·2 answers
  • Why is bone tissue classified as connective tissue?
    5·1 answer
  • A client with a complete tear of the rotator cuff in the right shoulder was given the choice between surgery and stem cell trans
    6·1 answer
  • the middle of tectonic plates tend to have fewer mountains than locations near tectonic plate boundaries. What might be one poss
    11·2 answers
  • Which of the following statements best compares genetic diversity in eukaryotes and prokaryotes?
    7·1 answer
  • In terms of natural selection, what is the best description of an organism that is fit?
    12·1 answer
  • What would be the result if crossing over did not happen during meiosis in humans?
    5·2 answers
  • Which processes relate to mechanical weathering check all that apply
    6·2 answers
  • PLEASE HELP THIS ASSIGNMENT IS DUE IN 15 MINUTES!!!!!!!!!​
    15·1 answer
  • The primary pigments contained in the epidermis are
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!