1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SIZIF [17.4K]
3 years ago
15

Ira brags about how wonderful he is, talks endlessly about his accomplishments, and pushes people to admire him. He lashes out w

hen his inflated sense of importance is threatened by others. Ira would rate high in a measure of ________.
Biology
1 answer:
IrinaVladis [17]3 years ago
8 0

Answer:

Narcissism

Explanation:

Narcissism is a kind of personality disorder in which a person has a sense of admiration, fragile self-esteem and heightened sense of self importance. People with such disorder face serious problems in their relationships and are always disappointed if not given favors and admiration. Other people do not prefer to stay around a narcissist. They have a tendency to monopolize communication ad perceive other people inferior to themselves.

You might be interested in
Luminance response can be tested with a(n) _____. i. near-range photometer ii. telescope photometer iii. illuminance meter
Furkat [3]

Luminance response can be tested with an option(d) I or II i.e, near range photometer or telescope photometer.

The luminous intensity per unit area of light traveling in a specific direction is measured photometrically as luminance. It indicates how much light enters, exits, or is reflected from a specific area and falls within a specified solid angle.

The visual system's ability to function depends heavily on luminance and contrast. Vision is impossible without light (luminance = 0), and without contrast, we are unable to see spatial or temporal patterns. The first stage in seeing, which enables all other visual processes, is the capacity to respond to brightness.

A photometer is a tool used to gauge light's characteristics. A photometer can be used to measure a light source's brightness, color, and flux among other attributes. Photometers gather radiation released by the light source to determine the wavelengths of light and atomic emissions.

The complete question is:

Luminance response can be tested with a(n)_____.

I) near-range photometer

II) telescope photometer

III) illuminance meter

A) I only

B) II only

C) III only

D) I or II

To know more about photometer refer to:  brainly.com/question/13961371

#SPJ4

4 0
1 year ago
Whats the difference between an autotroph and a heterotroph.?
kompoz [17]
Most autotrophs<span> make their "food" through photosynthesis using the energy of the sun.</span>Heterotrophs<span> cannot make their own food, so they must eat or absorb it.</span>
5 0
4 years ago
Read 2 more answers
Which of these subjects is MOST LIKELY to be studied in<br> ecology?
Brums [2.3K]

Answer:

How plants work and about plants, so agriculture?

Explanation:

P.S.

Hope this helps :)

Also tell me if this is wrong*

3 0
3 years ago
Read 2 more answers
How is it possible for two proteins in the same cell to perform different functions
DedPeter [7]

Enzymes are regulated by more than the binding of small molecules. A second method that is used all the time by eucaryotic cells to regulate a protein's function is the covalent addition of a phosphate group to one of its amino acid side chains. These phosphorylation events can affect the protein in two important ways.

8 0
3 years ago
The study of groups of organisms belonging to the same species living together is called.
vekshin1
Answer: population
hope this helped
3 0
3 years ago
Read 2 more answers
Other questions:
  • On earth, what is the force that causes an object to free fall?
    9·2 answers
  • Which of the following structures is not a component of a photosystem?
    7·1 answer
  • Check out this app! It's millions of students helping each other get through their schoolwork. https://brainly.app.link/qpzV02Ma
    14·2 answers
  • Consider the characteristics of moss and fern life cycles. Which of the following sets of statements is true?A. The gametophyte
    13·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • A woman who is a carrier for XLA marries a man who does not have the disorder. They have four sons. How many could be expected t
    5·1 answer
  • Which of the following is NOT present in both prokaryotes and
    13·1 answer
  • What rocks recrystallize to form metamorphic rocks?
    5·1 answer
  • Where is a divergent boundary most likely to be found?
    12·2 answers
  • What is the Cardiac Muscle Cell Appearance
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!