1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lunna [17]
4 years ago
8

Janine recently had surgery on the neck, or narrow lower portion, of her uterus. Janine's surgery was performed on the:

Biology
1 answer:
stira [4]4 years ago
3 0

Cervix

Janine recently had surgery on the neck, or narrow lower portion, of her uterus. Janine's surgery was performed on the cervix.  

The cervix is the narrow neck-like passage that forms the lower portion of the uterus in the human female reproductive system. The cervix joins the vagina and uterus and it is mainly made up of fibromuscular tissue. The two major parts of the cervix are ectocervix and endocervix. During menstrual cycle, the cervix opens a bit to allow the passage of menstrual flow. The cervix also dilates largely to allow the passage of baby during childbirth.


You might be interested in
What is biological science​
iren [92.7K]

Answer:

Biological sciences is the study of life and living organisms, their life cycles, adaptations and environment. Those who choose to study the biological sciences can expect to expand their knowledge of cell theory, evolution, genetics, energy and homeostasis.

6 0
3 years ago
Read 2 more answers
A geographical area where plants, animals, the landscape, and the climate all interact together is called a(n) (4 points)
Goryan [66]
An ecosystem is a geographical area where plants, animals, the landscape and the climate all interact together
6 0
3 years ago
Imagine an earthworm that has no chaetae. how would the lack of chaetae affect movement of the earthworm?
Usimov [2.4K]

The worm would be unable to burrow and dig through the soil. Chaetae are involved in the locomotion of the worm by giving the worm grip and <span>tools</span> to burrow <span>through</span> the soil. <span> </span>Chaetae <span>are</span> made of chitin project from the body wall <span>on</span> each segment are arranged in 4 pairs and are sited on the ventral surface - two pairs of ventral chaetae are found just either side of the midventral line and two pairs are further out in the ventrolateral position (that is just ventral of the side of the worm).

8 0
3 years ago
The of the cell directs cell activity and acts like the control center
ICE Princess25 [194]
The nucleus of the cell
6 0
3 years ago
Match each even to its description
romanna [79]

Answer:

Explanation:

The first one is Full Moon

The second one is New Moon

The third one is Lunar Eclipse

The last one is Solar Eclipse

8 0
3 years ago
Other questions:
  • Lists 3 characteristics that are used to describe air
    10·2 answers
  • What is precipitation
    10·2 answers
  • As countries develop, do they have more or less of an impact on the planet?
    13·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Which of the following are characteristics of Ascomycota? Check all that apply.
    10·2 answers
  • A mother is heterozygous for Type B blood and a father has type O blood, what is the probability of the offspring having Type B
    7·1 answer
  • When a blue fish mates with a yellow fish, all the baby fish have blue or yellow stripes. What percent of the offspring will be
    14·1 answer
  • The fish, coral, and a sea turtle shown in the photo are all part of which of the
    5·1 answer
  • Plz do 3 or 2❤️❤️❤️plz and thank u
    5·1 answer
  • Identify other land resources found on earth. Describe one use for each resource.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!