1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lara [203]
4 years ago
7

How did Renaissance artists contribute to the development of technical drawing

Biology
2 answers:
FrozenT [24]4 years ago
7 0

Answer: They were the first to illustrate building designs as a reference for artisans.

Explanation:

Anestetic [448]4 years ago
7 0

They would draw out building ideas and stuff like that to help planning stuff.

You might be interested in
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
How many different populations live in the pond?​
ioda

Answer:

Depends on the environment, climate and etc

Explanation:

6 0
3 years ago
Read 2 more answers
What factor about cellular respiration are you testing? ( what makes the three bottles different?)
Anika [276]

Answer:

Gas.

Explanation:

Gas which is present makes the three bottles different from one another. There are three factors which is used for testing of cellular respiration such as amount of oxygen consumed during this process, amount of glucose used and amount of carbondioxide produced during cellular respiration. During cellular respiration, oxygen used in order to break down glucose and releases high amount of energy with the waste materials such as carbondioxide gas.

5 0
4 years ago
The science of describing, naming, and classifying extant and extinct organisms is:__________
Sloan [31]

The answer is Taxonomy.

The science of describing, naming, and classifying extant and extinct organisms is <u>Taxonomy</u>.

What is taxonomy?

All of the world's plants, animals, and microorganisms are included in taxonomy, which is the science of naming, describing, and classifying species. Taxonomists identify, describe, and classify species, particularly those that are novel to science, using morphological, behavioral, genetic, and biochemical observations. Taxonomy recognizes and catalogs the elements of biological diversity, offering the fundamental information necessary for the management and application of the Convention on Biological Diversity. Unfortunately, our understanding of taxonomy is far from complete. Taxonomists have identified roughly 1.78 million species of animals, plants, and microorganisms throughout the past 250 years of study, but the true number of species is unknown and likely between 5 and 30 million.

Generally speaking, superficial categorization of living things develop according to necessity. Any crawling object, such as a snake, earthworm, intestinal parasite, or dragon, has been referred to, respectively, by the Anglo-Saxon phrases worm and fish. There are more anatomical distinctions between a shellfish and a starfish than there are between a bony fish and a man, despite the fact that the terms shellfish, crayfish, and starfish all include the term "fish." There are many different types of vernacular names. The English robin (Erithacus rubecula) is not the American robin (Turdus migratorius), for instance, while the mountain ash (Sorbus) only superficially resembles a real ash.

To know more about Taxonomy click on the link below:

brainly.com/question/11990223

#SPJ4

3 0
2 years ago
Why the dates on the geologic time scale are often changed and updated.
Mashutka [201]

Answer:

Absolute time measurements can be used to calibrate the relative time scale, producing an integrated geologic or "geochronologic" time scale. ... The overall duration and relative length of these large geologic intervals is unlikely to change much, but the precise numbers may "wiggle" a bit as a result of new data.

Explanation:

Hope this helps :)

7 0
4 years ago
Other questions:
  • During the implementation of an urban community nutrition program it was discovered that items packaged into food baskets could
    15·1 answer
  • Gust say DAD 10 time and you wi;; get 20 points
    10·1 answer
  • A researcher while working in vitro (outside cell) added helicase enzyme which resulted in the untwisting of the DNA helix. But
    11·1 answer
  • In a simple spinal reflex, the pathway for an impulse is along a sensory neuron directly to a motor neuron through ?A) an effect
    11·1 answer
  • In an enzyme-mediated reaction, the activation energy will be ________ the activation energy required for a reaction without an
    11·1 answer
  • Why is primase required for DNA replication?
    8·1 answer
  • Which would least likely result from a chromosomal change?
    14·1 answer
  • Examine the energy pyramid below. If a disease strikes the snake population in this food chain, what will be the initial effect
    6·2 answers
  • Identify the limitations of the carbon model(s) in accounting for all of<br> Earth's carbon.
    5·1 answer
  • How are art and conservation science connected in this sculpture?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!