1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inysia [295]
3 years ago
8

In eukaryotic cells, the process indicated by arrow A occurs in the

Biology
1 answer:
Dennis_Churaev [7]3 years ago
3 0
The correct answer for this one is this: "D. Cell Membrane." In eukaryotic cells, the process indicated by arrow A occurs in the cell membrane.
Here are the following choices:
<span>A. Cytoplasm
B. Ribosome
C. Nucleus
<span>D. Cell Membrane</span></span>
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Based on the cladogram, which of these organisms are the most closely related?
Drupady [299]
According to the cladogram, arthropods are MOST closely related to which group of organisms? mollusks. annelids. echinoderms.
7 0
3 years ago
An object has a kinetic energy of 32 J and a mass of 36 kg, how fast is the object moving?
marin [14]

Answer:

1.33 m/s

Explanation:

The formula for Kinetic Energy is given as:

K.E=\frac{1}{2} mv^{2} \\

Where, m is the mass and v is the velocity of the object. In order to tell how fast is the object moving we need to calculate its velocity.

Re-arranging the above equation and isolating v, we get

2 K.E = mv^{2}\\\\v^{2} = \frac{2 K.E}{m}

Putting values in this equation, we get:

v^{2}=\frac{2 \times 32}{36}\\\\ v^{2}=\frac{16}{9}\\\\ v=\frac{4}{3}\\\\  v=1.33

Thus, the object is moving with a velocity of 1.33 m/s

7 0
3 years ago
The blood of an organism is responsible for passing genes from parent to child.
leonid [27]

Answer:

This is false as genes are transferred to a fetus from the reproductive cells(sperm, Egg cells)

Explanation:

This is because humans have 46 chromosomes, however this is comprised of the 23 chromosomes in each sperm and egg cells. This shows that genes are not transferred through the blood but by sperm and egg cells. Also genes and chromosomes are stored in the nucleus of cells, however red blood cells do not have a nucleus further showing that this is false.

:)

7 0
3 years ago
Read 2 more answers
How do I adjust my model based off of fossil information?
Sindrei [870]

Answer:

Fossil is unable to change

Explanation:

7 0
3 years ago
Other questions:
  • Results in four daughter cells, each with half the number of chromosomes of the parent cell, as
    10·1 answer
  • In which type of reproduction can cells divide through the process of mitosis?
    11·1 answer
  • What is a hominid ?
    10·2 answers
  • Assuming the carbon cycle is a closed system, which of the following statements is true?
    11·2 answers
  • An ancient Greek physician believed performing lobotomies helped release inner spirits that caused mental illness. Please select
    5·2 answers
  • The nurse is caring for a female client with dysmenorrhea that interferes with activities of daily living. the client is prescri
    13·1 answer
  • Which invention led to advancements in the cell theory?
    12·2 answers
  • Some studies have indicated that our eyes naturally travel from bottom left to top right, so putting the diagonal along that pat
    5·2 answers
  • Which process and type ??
    11·1 answer
  • 1. The line "... form a more perfect
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!