1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inysia [295]
3 years ago
8

In eukaryotic cells, the process indicated by arrow A occurs in the

Biology
1 answer:
Dennis_Churaev [7]3 years ago
3 0
The correct answer for this one is this: "D. Cell Membrane." In eukaryotic cells, the process indicated by arrow A occurs in the cell membrane.
Here are the following choices:
<span>A. Cytoplasm
B. Ribosome
C. Nucleus
<span>D. Cell Membrane</span></span>
You might be interested in
What are the characteristics of carbon bonds?
Fofino [41]

Answer:

Carbon's characteristics include its ability to bond with oxygen, hydrogen, nitrogen, phosphorus and sulfur.

Explanation:

Carbon biochemical compounds are essential to all life on the planet. Because of its bonding ability, carbon can form single, double, or triple covalent bonds with other atoms.

7 0
3 years ago
How do the organelles move around In a cell
Flura [38]
Cytoplasmic uses actin and myosin for the movement of the cytosol  which causes the organelles to move inside the cell.
4 0
4 years ago
Which is the correct order of primary succession? A. lichens and mosses, pine and spruce, small herbs and shrubs, fir and birch
kondor19780726 [428]
<span> B. lichens and mosses, fir and birch, small herbs and shrubs, pine and spruce</span>
8 0
3 years ago
Read 2 more answers
A rock sits high on a mountain top. What may happen to this rock in the next hundred year?
miss Akunina [59]
The area around the rock will have weathered down and the rock will eventually either break or it will fall down the mountain
8 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Other questions:
  • What is black dog syndrome?
    8·1 answer
  • How does the redshift of distant galaxies best support the big bang theory?
    13·2 answers
  • When is mitosis necessary
    15·1 answer
  • 3 common similarities between a pig and a human embryo
    8·2 answers
  • A(n) _____ bond forms when two atoms share one or more pairs of electrons.
    9·1 answer
  • Which is a true statement about electromagnetic waves?
    14·1 answer
  • Is plasma the liquid portion of blood?
    6·2 answers
  • Trans fats are created when oil is changed to a solid by
    9·1 answer
  • What is the initial velocity of the reaction catalyzed by the wild-type enzyme when the substrate concentration is 10 mM?
    14·1 answer
  • Contractions during childbirth are an example of positive feedback.Select one:TrueFalse
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!