1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zalisa [80]
3 years ago
15

11.) When you catch a cold, your body tights the

Biology
1 answer:
nignag [31]3 years ago
3 0

Answer:

See explanation below.

Explanation:

Viruses cause problems when they enter the body and begin to grow and reproduce. They can have byproducts that are harmful. Strep throat for example gives off substances that cause inflammation in the throat. Some viruses can cause serious issues such as nerve damage, like polio. So the immune system works to recognize and deal with cells that might cause harm.

The first time that a particular virus moves in and attacks the body, the immune system - and the white blood cells - might be slow to recognize the issue and take some time to swing into action. But the next time that particular germs shows up, the body is ready for it and reacts much more quickly. The body us designed this way so that harm by invading germs can be halted or minimized.

Hope this helps! Have an awesome day!! :-)

You might be interested in
NEED ANSWER ASAP U WILL GET BRAINLIEST
Leya [2.2K]
I believe st marks because there<span> are no deltas or rivers that would intercept it.</span>
5 0
3 years ago
What part is the image shows a reproductive structure that forms offspring that are genetically distinct from its parents?
elena-s [515]
Try roots for an answer
7 0
3 years ago
Read 2 more answers
1. What happens to macromolecules from food during digestion?
NikAS [45]

Answer:

1. When you eat, you take in large molecules called "macromolecules" which make up building blocks that you can absorb into the bloodstream, and that your cells burn for energy.

2. Sugar molecules - Glucose, Amino Acids - Proteins, Fatty Acids - Fat

3 - 5 seems like answers you have to do yourself, but if you really need help just comment and I'll edit this!

Explanation:

5 0
3 years ago
Read 2 more answers
Help me please, I'll mark brainliest!!!
mario62 [17]
<h2>1 nature</h2><h2>2 ecology </h2><h2>3 water cycle </h2><h2>4 carbon cycle</h2><h2>5 chemical cycle </h2><h2>6 ecosystem </h2><h2>7 food chain </h2><h2>8 producers</h2><h2>9 consumers</h2><h2>10 decomposer</h2>
4 0
3 years ago
Read 2 more answers
The lipopolysaccharide (LPS) possessed by Gram-negative bacteria contributes to the virulence and pathogenic potential of these
Alexeev081 [22]

Answer:

A. Lipid A

Explanation:

The outer membrane of Gram-negative bacteria is present outside to the thin peptidoglycan layer. The outer membrane consists of lipopolysaccharide (LPS) which is the molecule having both carbohydrates and lipids.

The lipopolysaccharide has three parts out of which lipid A is the toxin one. Lipid A is embedded in the outer membrane through its fatty acids. When lipid A enters the blood stream of the host cell, it leads to septic shock. Lipid A is heat stable and highly toxic.

6 0
3 years ago
Other questions:
  • I need ONE MORE non-living thing that metabolizes.<br><br> I already have Viruses and Cars.
    6·2 answers
  • Three groups of students in Mr. Walker's science class were assigned the task of designing an experiment to test
    8·1 answer
  • 30 grams of ammonia (NH3), nitrite (NO2-), and nitrate (NO3-) are added to a soil sample.
    10·1 answer
  • When a wave is refracted,
    15·1 answer
  • Which of these statements best describes an interaction between the atmosphere, hydrosphere and biosphere? Strong winds blow ove
    15·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What kind of evidence-structural or molecular- is most helpful in making decisions about relationships between species? Explain
    14·1 answer
  • Of all of the sunlight energy captured by the seaweed,
    13·1 answer
  • In science, theories____?
    5·1 answer
  • The teacher noticed that Carrie seemed quite restless today and was having difficulty concentrating on any task that she started
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!