1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yuradex [85]
3 years ago
15

Which type of wetlands are shrub-filled, watery, coastal, freshwater bogs? a. fens b. marshes c. pocosins d. riparians

Biology
1 answer:
madam [21]3 years ago
5 0

Answer:

The kind of wetland that are shrub-filled,watery,coastal,fresh water bogs are Marshes.

You might be interested in
If a person with AB blood (genotype IAIB) produced an offspring with a person who’s IAi, what’s the chance that the offspring wi
antiseptic1488 [7]

Answer:

50% of getting A blood type

Explanation:

Using a punnet square you have (sorry cant do a square)

 <u>   IA            IB</u>

<u />

<u>IA</u>

<u />

<u />

<u>i</u>

<u />

Then you you add all the possible combinations from both parents genes

              IA               IB

IA          IA IA           IA IB

i            IA i               IB i

You now have a 50% chance of A type blood because the lowercase (i) wont change the blood type outcome because the IA over shines it.

7 0
3 years ago
Transpiration is the loss of oxygen through a plant’s leaves true or false
agasfer [191]

Answer:

in plants is responsible for the timing of seasonal activities such as flowering and growth.Transpiration is the loss of OXYGEN through a plant's leaves. False- water. When the guard cells of a leaf lose water, the stomata OPEN.

Explanation:

so the answer is True

4 0
2 years ago
What type of protein helps molecules move through a<br> cell membrane?
Hitman42 [59]

Answer:

Gated Channel protein

Explanation:

4 0
3 years ago
Read 2 more answers
One difference between DNA and RNA is that
dybincka [34]
A is the answer. Hope that helped.
7 0
3 years ago
Read 2 more answers
Which statement describes Mendel’s hypotheses regarding gametes?
anyanavicka [17]
A. A gamete carries to genes for a trait.
B. A gamete carries one allele for a gene.
C. A gamete can carry multiple alleles for a trait.
D. Some gametes are dominant and some are recessive.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Electricity will not generally cause
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Explain what air pressure indicates with weather
    9·1 answer
  • The most biomass is an energy pyramid is the
    14·2 answers
  • Which term defines a small, irregularly shaped body made of rock or organic material that orbits the sun
    8·1 answer
  • Which type of tissue performs the role of signal conduction in the body? A. connective tissue B. epithelial tissue C. muscle tis
    13·1 answer
  • No Light<br> Yo =<br> Gas<br> Gas<br> Water<br> Plant
    9·1 answer
  • What could cause a population to reach it's carrying capacity?
    7·2 answers
  • How does temperature of the Earth surface increase due to ozone layer depletion write in brief​
    6·1 answer
  • How is the law of conservation of mass applied to ecology?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!