1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klasskru [66]
3 years ago
7

Which cells is a phagocytic leukocyte that can engulf a foreign bacterium?

Biology
1 answer:
andrey2020 [161]3 years ago
5 0

Answer:

Phagocytosis and inflammation

Explanation:

A neutrophil is also a phagocytic leukocyte that engulfs and digests pathogens. Neutrophils, the most-abundant leukocytes of the immune system, have a nucleus with two to five lobes and contain organelles (lysosomes) that digest engulfed pathogens.

thats the answer

hope this helps

You might be interested in
Natural and artificial selection depend on genetic and phenotypic variation. In natural selection, the selective pressure comes
otez555 [7]
<h2>B) option is correct </h2>

Explanation:

Natural selection is a selection pressure which operates in a population and allow the best fitted genotype to survive in changing environmental conditions and eliminate the other genotype which are not fit

In artificial selection, breeders select superior breed for the breeding purpose so that this type of selection favors the superior genotype and eliminates inferior genotype, thus leading to genetic drift

Stabilizing selection is a type of natural selection in which intermediate genotype is favored but extreme genotypes (inferior and superior) are eliminated

In the given example of pigmentation in pigeons, breeding is selectively done with intermediate pigmentation hence intermediate genotypes will be favored

5 0
4 years ago
Plz help fast! If an earthquake that started on land moves to the ocean what would happen to its speed?
SOVA2 [1]

Answer:

The Pacific Plate moves northwestward past the North American Plate along the San Andreas.

Explanation:

5 0
3 years ago
What are the differences between animal and plant cell?
Helen [10]
The differences are animal cells are rectangular whereas plant cells are rectangular. Plant cells have a digit cell wall called that surrounds the cell membrane. Animal Cells do not have cell membranes.
7 0
4 years ago
Read 2 more answers
What is another property of ionic compounds?
Nesterboy [21]

Answer:

They form crystals

They have high melting points and high boiling points

They have higher enthalpies of fusion and vaporization than molecular compounds

They're hard and brittle

They conduct electricity when they are dissolved in water

They're good insulators

Explanation:

i hope this is what you need

7 0
3 years ago
Organization is one of the characteristics of life. Explain how your observations under the magnifying glass support this idea.
seraphim [82]

Answer:

All living things are made up of cells. Cells are building blocks of life. Cells are the simplest level of organization. The structure of multicellular organisms are made up of many parts that are required for survival of organisms. The level of organization in multicellular organisms includes: cells, tissues, organs and organ system. The organization is necessary for the body of the organisms to function properly as a characteristic feature of living being.

Magnifying glass is a convex lens that is fitted in a microscope can be used to magnify the image of object under observation. A magnifying glass in a microscope can be used to magnify minute cells and small living creatures. All cells aggregate to form tissues. It can be used to see the arrangement of cells in a tissue specimen and small organelles like chloroplast, mitochondria, nucleus and others.

Therefore, observations under the magnifying glass support  the idea of organization is one of the characteristics of life.  

5 0
4 years ago
Other questions:
  • Which organ is the male copulatory organ? vas deferens/testes/ scrotum/ penis
    13·2 answers
  • 1. A mutation that causes changes in the amino acid sequence downstream of the mutation is called
    13·2 answers
  • Give three examples of of potential energy converted to kinetic energy.
    13·1 answer
  • How do greenhouse gases such as CO2 and N2O contribute to an increase in Earth’s atmospheric temperature?
    7·2 answers
  • As altitude increases, what happens to air pressure
    10·2 answers
  • Group name given to the first life forms which developed on earth about 3.8 billion years ago
    10·1 answer
  • The mesentery attached to the inferior margin of the stomach is called the ________.
    5·1 answer
  • Why does a kiwi fruit have a higher chance of reproduction?
    10·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • 50. What type of waste is excreted from the lungs?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!