1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stich3 [128]
3 years ago
8

When the mouth develops from the first opening in the gastrula, the organism is called a deuterostome.

Biology
1 answer:
devlian [24]3 years ago
6 0

Answer:

False.

Explanation:

Classification of organism is important to classify them in similar and different groups. Organisms can be classified on the basis of the development of the mouth or the anus first.

The organism in which mouth develops first by the opening of gastrula are called protostome not deuterostomes. Deuterostome develop anus first from the opening of gastrula.

Thus, the correct answer is option (b).

You might be interested in
Which of the following is a unifying characteristic of life?
lisabon 2012 [21]

Answer:

where is option I can't see

5 0
3 years ago
What do we pass onto future generations?<br> A. Bacteria<br><br> B. DNA<br><br> C. Homework
musickatia [10]
DNA I’m not sure if im right sorry if im wrong
4 0
2 years ago
Read 2 more answers
Which is a result of a seasonal change (meaning a change that happens over
weqwewe [10]

Answer:

A. Chipmunks sleeping underground through the winter

Explanation:

A seasonal change in the behavior of a living organism is a change that occurs every year at a particular time. The reasons for the occurrence of such changes are so that the organism has advantage in survival in the environment. In this case we have the chipmunk that sleeps underground through the winter. We have an animal which exhibit a seasonal change every year, during the winter period. The reason for this is that the chipmunks have very quick metabolism, so if they are active during the winter they will starve because of lack of food. Instead, the chipmunks have evolved to hibernate during the winter, thus slowing down the work of their hurt during the winter and sleep, until the spring comes.

3 0
3 years ago
Read 2 more answers
The kidneys are stimulated to produce renin ________. A. by a decrease in the blood pressure B. when the specific gravity of uri
tresset_1 [31]

Answer: A

Explanation: I hope this helped! :)

7 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • Why is decreased genetic variation in a species considered a negative impact of genetic technologies?
    14·2 answers
  • During the replication of DNA, __________.
    13·1 answer
  • Which of these changes produces a chemical change?
    7·1 answer
  • 1pt Place the following steps in the correct order:
    14·1 answer
  • PLEAS HELP ME IT IS A GRADE!!!<br><br> BIOLOGY
    14·1 answer
  • Which statement is true about Earth's poles?
    13·2 answers
  • Match the terms to their definition. 1. constructive a process in which the edge of one crustal plate sinks below the edge of an
    6·1 answer
  • Antibodies start the inflammatory response. True or False?????????
    5·2 answers
  • PLEASE SOMEONE HELP ME PLZ!!!!!Photosynthesis is/ is not an example of the Law of Conversation of Mass
    8·1 answer
  • You approach the edge of a pond filled with ducks. the ducks are swimming, but when they see you, they approach the shore and co
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!