1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Veseljchak [2.6K]
3 years ago
5

One way to describe a species is as a population adapted to a certain niche. That population has a small gene pool. If the membe

rs of different species could interbreed with each other, too much genetic variability would occur in that gene pool. Too much genetic variability would
Biology
2 answers:
dedylja [7]3 years ago
7 0
In determining species, it is best to differentiate in terms of the population that is being adapted in which, a certain niche. So, if it has a small gene pool, and the different species will be interbreeding each other with a much genetic variability in gene pool, it would most likely cause a less adaptation. The niche will be having a less adaptation if too much genetic variability will occur.
pickupchik [31]3 years ago
7 0

Answer: the answer is B

Explanation:

You might be interested in
The three structural components of the modal model of memory are:
masha68 [24]
These are sensor, registry and short-term memory.
3 0
3 years ago
When our brain fills in missing pieces, this is called:
Darina [25.2K]

Answer:

I think it's called 'filling in'

Explanation

Hope this helps :)

5 0
3 years ago
Read 2 more answers
Why is water considered to be abiotic?
shtirl [24]
<span>Water is considered an abiotic factor in the ecosystem because it is a non-living part of the ecosystem. Although water is abiotic, it has great impacts on both living and non-living things. Water is very important to al living things and no living organism can survive without it. Other abiotic factors in the ecosystem are soil, rocks, sunlight, oxygen, etc.</span>
3 0
3 years ago
Read 2 more answers
When are leaf and leaf-bud cutting used
dimaraw [331]

Answer:

when there is a shortage of propagating material, as these cuttings can give one and perhaps two plants from each node

Explanation:

5 0
2 years ago
An ancient marble statue is moved from a rural location to a highly polluted city. Explain how the move might affect the statue
Kamila [148]
When sulfurous, sulfuric, and nitric acids in polluted air and rain react with the calcite in marble and limestone, the calcite dissolves. In exposed areas of statues, we see roughened surfaces, removal of material, and loss of carved details
6 0
3 years ago
Other questions:
  • When a solution of cesium chloride (CsCl) is subjected to high-speed centrifugation, a stable density gradient is formed. Mesels
    11·1 answer
  • Which is considered the first stage of the cell cycle?
    13·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following can fix nitrogen?
    7·2 answers
  • The tendency for two species to diverge in size of body parts associated with feeding is called
    10·1 answer
  • In circumstances where the body requires prolonged or increased levels of a hormone, the DNA of target cells will specify the sy
    7·1 answer
  • In eukaryotic cells, dna replication occurs in the
    12·2 answers
  • The *Blank* is a spherical region that surrounds the solar system and extends almost halfway to the nearest star
    13·1 answer
  • NEED HELP ASAP !!! I ALSO HAVE MORE BIOLOGY QUESTIONS ON MY PROFILE PLS HELP
    15·1 answer
  • Are the prokaryote’s components right?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!