1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blsea [12.9K]
3 years ago
11

Where does the movement energy found in falling rain come from originally?

Biology
1 answer:
Tresset [83]3 years ago
6 0
A. i think its this because they get their energy from gravity. its originally potential energy as a cloud but as the water droplets condense and collect into rain drops they get heavy and that potential energy is turned into kinetic energy. this isnt up there so A.
You might be interested in
The diagram below shows the stump of a tree whose root grew into a small crack in bedrock and split the rock apart.
Zina [86]
A physical weathering k
4 0
3 years ago
Read 2 more answers
What happens to water when it freezes?
Slav-nsk [51]
It turns into a solid and if you melt it it becomes a liquid and if you boil it it becomes a vapor
6 0
3 years ago
Read 2 more answers
What is turgor what causes it and what does it do for a plant
Rasek [7]

Pressure exerted by fluid in a cell that presses the cell membrane against the cell wall. Turgor is what makes living plant tissue rigid. Loss of turgor, resulting from the loss of water from plant cells, causes flowers and leaves to wilt.

5 0
3 years ago
Read 2 more answers
QUESTION 1
Paladinen [302]

Answer:

1. RNA

2. Cytosine and guanine

3. RNA

4. Replication

5. Unwinding the double helix

6. DNA polymerase

7. Identical

8. Repair the DNA

9. Changes in nucleotides of a DNA molecule that affect the genetic message

10. The gene for beta-galactosidase turns off.

11. p53

12. A part of DNA that does not code for a functional protein

13. Proteins

14. Transfer RNA

15. The making of an RNA molecule from a DNA strand by pairing of bases of RNA nucleotides with the complementary bases in DNA

16. 3

17. Tertiary

18. Enzymes

19. The reaction slows down.

20. The active site of an enzyme

21. 60%

22. Conserved energy

23. different

24. Gene expression

I hope that this helps you !

5 0
3 years ago
What is a list of types of organisms in an eco pyramid?
gtnhenbr [62]

Termites, koalas, field mice, and deer.

7 0
3 years ago
Other questions:
  • A testable hypothesis could be formed from which question
    15·2 answers
  • What might be an advantage of collecting evidence in a natural setting rather than in a lab?
    12·1 answer
  • Iron is a type of metal. Therefore, the iron has a sparkling surface nature. However Iron is easy to rusty. Why?​
    13·1 answer
  • What is one of the principal chemical compounds that living things use to store energy
    15·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • How are Earth and Venus similar? And what are there differences?
    11·2 answers
  • Groups of similar cells that work together
    10·1 answer
  • If you are walking on an island formed by an underwater volcano,
    14·2 answers
  • What is photosynthesis..?
    11·2 answers
  • Which one of the following criteria is necessary for natural selection to occur?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!