1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
4 years ago
12

In fruit flies (Drosophila melanogaster) grey body is dominant to black body and normal wings are dominant to vestigial wings. I

f a heterozygous grey fruit fly is mated with a black-bodied fruit fly, what proportion of the offspring would be black?
A. 0
B. 0.25
C. 0.5
D. 1
Biology
1 answer:
zepelin [54]4 years ago
6 0
The answer is C. We can suppose that the Grey gene is "A" and Black gene is "a". So the gene of heterozygous grey fruit fly is "Aa", and the black-bodied fruit fly is "aa". After mating, the offspring can get only "a" from balck-bodied fruit fly and has equal opportunity to get a "A" or "a" from heterozygous grey fruit fly. If the gene of offspring is "Aa", it will be grey. If "aa", it will be black. So the proportion of being black is 0.5.
You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
PLZ HELP <br>what are 2 scientific names and is written in Latin for the Purple Loosestrife.​
GuDViN [60]

Answer:

lythrum salicaria and rainbow weed

6 0
3 years ago
Hellooo help please! no random stuff just 50$$!! or coins-
Reika [66]

answer:

i would have to say B or C. leaning more one C though, i hope i'm right haha. best of luck!! :D

6 0
3 years ago
What are the methods of protein structure determination of biomacromolecules?
Alex73 [517]

Answer:

X-ray crystallography diffraction imaging, nuclear magnetic resonance spectroscopy imaging and frozen electron microscopy three-dimensional reconstruction technology.

Explanation:

http://www.creative-biostructure.com/protein-crystallization-and-structure-determination_13.htm

8 0
3 years ago
What type of blood vessel is A
quester [9]
<span>What type of blood vessel is A?
The blood vessel is a artery
It carries blood away from the heart. Hope this helps. :)

</span>
3 0
3 years ago
Other questions:
  • Where are the proteins of the electron transport chain located
    5·1 answer
  • Why is soil composition important?
    9·1 answer
  • Which is usually colder, A deep current or a surface current.....PLEASE HELP
    8·2 answers
  • narwhals are aquatic mammals known for the giant tusk that protrudes from their upper lip. these mammals live in arctic waters a
    7·1 answer
  • Respiration _____, and cellular respiration ______.
    6·1 answer
  • Which of the following valve closings can be auscultated during the "dupp" heart sound by placing the stethoscope at the left st
    9·1 answer
  • 2. Nuclei are roughly spherical in shape, and
    9·1 answer
  • What are global wind patterns called? La Niña local winds prevailing winds El Niño
    13·2 answers
  • Choose all the answers that apply. Which of the following are types of slope failure?
    13·2 answers
  • In which part of the ocean do the greatest number of organisms live?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!