1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sveta [45]
3 years ago
6

Which of the following can be said about the use of agriculture?

Biology
2 answers:
LUCKY_DIMON [66]3 years ago
8 0
<span>the one that can be said about the use of agriculture is : It has included practices that led to pollution of soil and water For example, the use of pesticides during the agriculture process. The use of pesticides has proven to damage the nutrient level of the soil and increase the toxicity level of water's supply</span>
alekssr [168]3 years ago
3 0

C. it has included practices that led to pollution of soil and water

You might be interested in
Finfish, ocean catches, and fish-farming provide approximately what percentage of
Lynna [10]

Answer:

30 percent

Explanation:

Protein is essential in living organisms. They are the building blocks of life and help in the replacement and repair of work out tissues of the body. There are various sources of protein which are plant sources and animal sources.

Animal sources include land and aquatic animals.Sea Finfish, ocean catches, and fish-farming provide approximately 30

percent of animal protein sources consumed by humans in the world.

5 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
suppose a persons stomach wall was irritated by an over-secretion of stomach acid. why do you think a person would take milk of
il63 [147K]

The pH of stomach secretion is low. This means it is acidic. Too much production can corrode the stomach wall. Therefore in such a situation drinking a basic solution with a higher pH neutralizes some of the stomach acidic secretions hence relieving the effect;

Acid + Base - Salt + Water  



5 0
3 years ago
What type of organisms are plants and elgie
kondaur [170]
The category is just called plants
 
<span />
4 0
3 years ago
The producers at the beginning of Earth's food chain are _____
Arturiano [62]
The producers at the beginning of the Earth's food chain are plants.
6 0
3 years ago
Other questions:
  • this yeast population growth data that you are given is an example of which pattern of population growth: exponential and logist
    7·1 answer
  • A fracture in which cranial bones are pressed down inwardly toward the brain is called a depressed fracture
    15·1 answer
  • A certain mutation is passed to offspring of the affected​
    9·1 answer
  • while washing her hair olivia noticed that she was losing a lot of hair she visited a clinic and the physician reassured her tha
    5·1 answer
  • Lizette’s teacher suggests that she use a strong solution of vinegar to kill the weeds. Vinegar is acidic and prevents plants fr
    12·1 answer
  • How do you tell if the pedigree is recissive ordominant? By the wa the cirlces and squares with all da lines andscribbles are sh
    12·1 answer
  • PLZ I NEED HELP AND THX
    7·1 answer
  • Which of the following is a long-term impact of an oil spill on the environment?
    11·1 answer
  • PLEASE HELP DUE TODAY!!!!
    12·1 answer
  • What type of fiber-cable problem is caused when pairing a 50-micron core cable with a 62.5-micron core cable?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!