1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksano4ka [1.4K]
3 years ago
8

The stratosphere

Biology
1 answer:
makvit [3.9K]3 years ago
5 0

Answer:

is used by commercial airplanes

Explanation:

The stratosphere is used by most commercial airplanes. This is because this layer of earth is stratified and more stable.

  • The lowest level of the atmosphere is the troposphere.
  • This layer is where all the bulk of the atmospheric gases are domiciled.
  • Weather conditions occur here.
  • This layer is not safe for flight due to its turbulent nature.
  • The ionosphere is responsible for the transmission of radio signals around the earth.
  • The earth's weather occurs in the region of the troposphere.  
You might be interested in
What makes human dna different from oak tree or frog DNA?
lara31 [8.8K]

oak tree DNA is much longer than that in human and the number of chromosomes also differ

4 0
3 years ago
Read 2 more answers
I don't know how to delete this
cluponka [151]
It be like that sometimes
8 0
4 years ago
9. Which of the following can be demonstrated by blood types: incomplete dominance, multiple alleles, codominance, principle of
creativ13 [48]
Incomplete dominance,Is fit.
6 0
3 years ago
Read 2 more answers
What is the nature of the majority of the water on Earth?
kvv77 [185]

Answer:

D: salty

Explanation:

The Majority of the earth is made of the ocean

i'm not sure this is correct tho

7 0
3 years ago
Read 2 more answers
Which of these are the two major sources of nitrate pollution in rivers?
nikklg [1K]

Answer:

The correct answer is <em>c. animal wastes and fertilizers. </em>

Explanation:

Two major sources of nitrate pollution are farming and breeding activities. There are also certain industrial activities involved in nitrate pollution, but in general, these industries are related to agriculture.

The indiscriminate use of fertilizers for several years in intensive productions produce high nitrate concentration in soil and consequently elevate the risk of nitrate lixiviation.

Breeding animals produce nitrate pollution by their wastes, which accumulate and are not treated. These wastes include flesh, hair, feathers, skin, fat, liquids, excrements, among others. These wastes are an important source of nitrate.

In many cases, animal wastes are used by farmers as organic matter to improve their production. But excessive and incorrect use of it might produce severe damage in water sources.

4 0
3 years ago
Other questions:
  • True or false RNA is synthesized from viral DNA in an infected cell before protein synthesis begins.
    8·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What responses are observed in a person experiencing acidosis, a condition defined by the ph of the blood falling below 7.4?
    11·1 answer
  • Atmospheric air pressure is measured with a ______.
    10·1 answer
  • Which geologic feature forms when a central crack forms where a thin section of earths crust breaks and molten rock seeps out
    10·1 answer
  • What happens to pyruvate molecules formed in glycolysis in the absence of oxygen?
    10·1 answer
  • How are models used
    8·2 answers
  • When potatoes are in the ground, do they swell with water when it rains? If not, how do you explain that, and if so, what would
    8·1 answer
  • Is it close to the end of the world
    12·2 answers
  • Indicate structural adaptations of Mitochondria for its function​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!