1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
____ [38]
3 years ago
6

fungal and protist infections, especially those that are deeper than the skin, are especially hard to treat. why?​

Biology
1 answer:
matrenka [14]3 years ago
5 0

Answer and explanation:

Fungi and protists are eukaryotic. However, antibiotics selectively targets prokaryotic cells. Thus, the use of antibiotics for the treatment of fungal and protist infection is of no use at the first place. Secondly, if we use the other medicines that could kill the fungi/protists (e.g. fungicides), they could also kill the host's cells (animal's cells). This become further difficult if the infection is deeper in the skin. This is because, we would not be able to apply the medicine as direct application on skin but would give either intravenous or via food. This would increase the chance of imacting negatively the other organs/cells. The only option in such scenario is the surgery, which cannot be 100% effective because some spores may left even after the treatment.

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
How does the ribosome know how to make the protein.?
alexdok [17]
According to google

So the ribosome moves along way and many tRNA molecule transport the correct amino acid to make the correct sequence which is to be formed and only stops when mRNA shows 'STOP' codon. So there is a chain of polypeptide which is synthesised by copying the DNA and this is how proteins are made.

and for clarification t-RNA is transfer RNA and m-RNA is messenger RNA
6 0
3 years ago
Someone help me please
r-ruslan [8.4K]
Because there are too many sex chromosomes I think
8 0
3 years ago
Approximately twenty plant species provide about 90% of the world's food. All major food crops, including corn, wheat, and soybe
Olenka [21]
The answer is C) Increase genetic variation and breed plants to contain the wild variety.
8 0
3 years ago
Read 2 more answers
Alisa is studying the way in which men and women select partners to marry. She notes that across 37 cultures, one study found th
Alja [10]

Answer:

The correct answer will be option-A

Explanation:

The practice of marriage is practised in every culture which is associated with the union of the boy and a girl to which they are committed to spending a life-long relationship.

The studies on the preferences shown by the woman who has to get married have to look for the boys who are career-oriented which could provide a good earning to feed them and their family and fond of children to establish a family which will help develop the stronger relationship between them.

The girls ignored the attractiveness feature of their spouses as in a long term relationship attractiveness does not matter because of the feeling of love and strong bond between them.

Thus, option-A is the correct answer.

4 0
3 years ago
Other questions:
  • How are the scale like parts of hair formed?
    10·1 answer
  • Why do the global wind and weather pattern move form the polar regions south toward the equator??
    11·1 answer
  • Someome who studies ocean currents is called
    7·2 answers
  • After a major environmental change, what happens to species that do not adapt or move?
    6·1 answer
  • Please help due tonight 40 points!!
    15·2 answers
  • Will give Brainiest!
    8·2 answers
  • A relationship in which one species benefits and the other is harmed is
    14·2 answers
  • How can you tell me when energy has been transferred? Can you plz Explain support &amp; claim PLz HElP!!!​
    7·1 answer
  • Why environmental health is a community issue​
    6·1 answer
  • an international, multicenter, prospective study of a prothrombin complex concentrate, prothromplex total®, in anticoagulant rev
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!