1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fofino [41]
3 years ago
8

During the cardiac cycle, the bicuspid valve closes:

Biology
1 answer:
Fiesta28 [93]3 years ago
3 0
The correct answer is C
You might be interested in
What would happen to an organism if its cells contain no dna ? answers?
Anna71 [15]
DNA is verry important to life. It is the instructions or the blueprints of how to make (and makes up) the organism. Without it life as we know it is just not possible.
6 0
3 years ago
help please!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!What is the dew point? A. The time of day when gas condenses. B. The density at whi
Klio2033 [76]

your answer is C. it is temp where water vapours start to condense and forms liquid droplet from vapour condition.

hope it helps. please mark for best answer if you liked it.

4 0
3 years ago
Read 2 more answers
Most modern forms of transportation are powered by fossil fuels. Carbon dioxide, methane, carbon monoxide, and other gases are r
attashe74 [19]
The correct answer is the last option.

The first option (unable to cause climate change) is incorrect because these gases do effect the atmospheric temperatures by increasing them.
The second option is incorrect because while these gases do cause more water vapor to condense, they result in acid rain (not wetter climates). 
7 0
3 years ago
Read 2 more answers
What do i do? to help you?
densk [106]
You can answer questions
6 0
3 years ago
Read 2 more answers
A hypothesis is a ___.
Aloiza [94]

Answer:

A hypothesis is a tentative/ preliminary statement of the relationship between two or more variables. <u>It is a specific, testable prediction about what you expect to happen in a study.</u>

Explanation:

In science, the hypothesis is an idea or explanation that you then experience/test through study and experimentation. Outside science, theory or guess can also be called a hypothesis. The hypothesis is nothing more than an unbridled, wild guess but less than a well-established theory.

So, we can conclude that <em>The hypothesis</em><u> is a simple statement that defines what you think the outcome of your experiment will be.</u>

<em>Hope</em><em> </em><em>this helps</em><em>.</em><em>.</em><em> </em>

<em>Good</em><em> </em><em>Luck</em><em>!</em>

8 0
3 years ago
Read 2 more answers
Other questions:
  • In some species, young individuals float freely as plankton while mature members are fixed on the seafloor. this is an effective
    11·1 answer
  • One in every ____ infants are born with down syndrome.
    15·1 answer
  • You’ve been called to the scene of a murder. The lock on the victim’s apartment door was broken, likely by a crowbar found in th
    11·2 answers
  • Which of the following examples shows the influence coal has had on human activity?
    6·1 answer
  • Why will global warming lead to the extinction of some organisms?
    13·1 answer
  • What occurs if the Dna is used up​
    7·1 answer
  • The what surrounds the heart in humans
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • A mutation that can be inherited by offspring would result from A) random breakage of chromosomes in the nucleus of liver cells
    15·1 answer
  • Amoeba sisters: cellular respiration
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!