The nurse can give the client antidepressants such Duloxetine. Even though one is not depressed, one can still take this as this can also alleviate pain. Another medication the client can take is an anti seizure medication. An example of this is Pregabalin. It would prevent nerves from sending pain signals to the brain thus can also help ease the pain of a person suffering from Fibromyalgia.
Qualitative data is when you can see the ecosystems. the importance of biodiversity for all sustainable ecosystems is biodiversity boosts ecosystem productivity whether each species, no matter how small, all have an important role to play.
Answer:
it illustrated natural selection because the most favorable traits live longer than the unfavorable traits.
Explanation:
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer:
Principle of cross-cutting relationships
Explanation:
The geologic principle that will provide the most profound explanation to this problem is the principle of cross-cutting relationships.
It states that "features that cross-cuts rocks are younger than the layer they cut through".
Some of these features are intrusions, faults and joints.
The logic behind this reasoning is that without the rock in place, the cross-cutting event wouldn't have been recorded.
We can liken this to a fracture on the wall of a building. If the wall is not erected, there wouldn't be any fracture. Therefore, the fracture is far younger than the wall.
