1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
asambeis [7]
3 years ago
11

When does en element become a different element?

Biology
1 answer:
kotykmax [81]3 years ago
8 0
I think answer is B. Sorry if it is wrong.
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Which of the following is an example of Mendel’s Law of Dominance? * 1 point A dog breeder breeds a brown dog and a black dog an
Mashutka [201]

Answer:

A dog breeder breeds a brown dog and a black dog and all the puppies are brown.

Explanation:

This is because of the Mendelian inheritance order of characteristics. In all other example, there are several other things that don't align with this order like gender variability, specie variability etc.

All the puppies are brown and this shows proper and complete dominance in accordance with the law...

6 0
2 years ago
Read 2 more answers
A geneticist wants to determine what mutation in a DNA molecule changed the structure of a specific protein. What would the scie
Serhud [2]

Answer:

Explanation: 1+1

3 0
2 years ago
Why should a community use sustainable practices to produce food?
9966 [12]
The answer to this question is :B
3 0
2 years ago
Read 2 more answers
What is life process?<br><img src="https://tex.z-dn.net/?f=%7B%20%5Cpmb%7Bbrainliest%20%5C%3A%20assured%7D%7D" id="TexFormula1"
Irina-Kira [14]

Answer:

the basic functions performed by living organisms for their survival and body maintenence are called life process.

Explanation:

life process require energy which is provided by nutrition .

basic life processes are : nutrition , respiration , transportation , excretion .

5 0
3 years ago
Read 2 more answers
Other questions:
  • Is ammonia solution a weak or strong alkali?
    8·2 answers
  • Which types of embryos have pharyngeal slits
    11·2 answers
  • A scientist conducted an investigation about the effects of diet on disease resistance in mice and made surprising observations.
    13·1 answer
  • 1. Describe the movements of transverse adduction and flexion for the pectoralis major and biceps brachii muscles.
    15·1 answer
  • Which hemisphere controls non-verbal processing including spatial, musical, and visual tasks?
    14·1 answer
  • Which category of environmental worldview do you think would be most likely to lead to a sustainable future if it were widely ac
    15·1 answer
  • Why does the earth have different layers?
    9·1 answer
  • I’ll really appreciate it if you help me out with these 2 questions .
    8·1 answer
  • What is A layer that covers a cell's surface and surrounds the cell. It acts as a barrier between inside of
    9·1 answer
  • When we exercise, our bodies utilize macromolecules. The graph below is showing
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!