1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nordsb [41]
3 years ago
8

What physical property of the soil is rough

Biology
1 answer:
torisob [31]3 years ago
6 0
Texture i  think because that is the only way you can determine if anything is  rough or not
You might be interested in
What is the function of the NADH/FADH molecules?
klio [65]
NADH is a crucial coenzyme in making ATP. It exists in two forms in the cell: NAD+ and NADH. The first form, NAD+, is called the oxidized form. When a molecule is in an oxidized state, it means it can accept electrons, tiny negatively charged particles, from another molecule. After it gets the electrons, it has a negative charge, so it also picks up a hydrogen atom from the surrounding environment, since hydrogen atoms are positively charged. Now, we have the reduced form, or NAD
5 0
3 years ago
Which chemical bond is most common in living things? a. ionic bond b. metallic bond C. covalent bond d. hydrogen bond​
Ivenika [448]

Answer:

hydrogen bond

Explanation:

i think because humans have water in the body that has hydroden maybe

4 0
3 years ago
Elaborate on the reason that "cola" type drinks are used to make effective marinades.
Vlad [161]
I think its b............
3 0
4 years ago
Read 2 more answers
3. There was a drop in the rate of motor vehicle deaths between 1950 and 1975 and then again between
Luba_88 [7]
Seat belts and airbags were inserted into cars around the time of the late 1950s so the rate of death during a car accident would decrease because people are more likely to survive. And then in 1991 Side Impact Protection System (SIPS) was placed into cars again reducing fatalities during a car incident as people became more protected. :)
6 0
3 years ago
Anatomical features that are fully developed and functional in one group of organisms but reduced and functionless in a similar
Kryger [21]

We can confirm that Anatomical features that are fully developed and functional in one group of organisms but reduced and functionless in a similar group are termed vestigial.

<h3>What are vestigial features?</h3>

These can be thought of as features that belonged to ancestors of a specific species and are no longer needed, and thus have been reduced to functionless vestiges through many generations of evolution. The appendix is one such example in humans.

Therefore, we can confirm that Anatomical features that are fully developed and functional in one group of organisms but reduced and functionless in a similar group are termed vestigial.

To learn more about vestigial features visit:

brainly.com/question/15054414?referrer=searchResults

5 0
2 years ago
Other questions:
  • We often label ailments by the___they impact.<br><br> A) Organ<br> B) Organ System<br> C) tissue
    7·1 answer
  • Explain the process of mitosis in a tissue culture for normal cells.
    14·1 answer
  • Which scientist worked with decks of cards to develop the arrangement of
    5·1 answer
  • Her immune system is exhibiting the _ line of defense. This defense is part of _ immunity.
    7·1 answer
  • Demography is the study of _________
    8·1 answer
  • Why is agriscience so concerned with the environment?
    15·1 answer
  • Why are sedimentary rocks found as a veneer
    5·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Is meiosis genetically identical?
    6·1 answer
  • Plz help<br> nnnnnnnnnnnnnnnnnnnnnnn
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!