1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
3 years ago
14

A woman of normal weight may have, on the average, _____ percent of the body weight as fat. 5 10 15 20

Biology
1 answer:
ryzh [129]3 years ago
7 0
15 i think not 100%^ sure
You might be interested in
True or False:
Oduvanchick [21]
True. such as with pesticides, they are used to reduce harmful insects to crops but they often re harmful to the health of people consuming those crops
4 0
3 years ago
??????????????????!????
makvit [3.9K]

Dominant: the more common trait (brown hair)

Recessive: a trait that doesn't show up unless both parents carry it (blue eyes)

Co- dominant: both traits show up and co- exist (AB blood)

Incomplete dominance: when a dominant gene does not completely mask a recessive gene so they blend (pink flower)

Phenotype: physical trait- able to be seen (stripes on a zebra)

Genotype: genetic makeup of an organism - genetic trait

Hetrozygous: different (Bb)

Homzygous dominant: same and dominant (bb) and (BB)

Purebred: same as homzygous- has same alleles (bb) and (BB)

Hybrid: also known as heterozygous traits

1.

75%

25%

orange (AA) blue (aa)

2 orange Aa

2.

0%

100%

Hetrozygous

7 0
3 years ago
Why is soil important to plants?
Elena-2011 [213]

Answer:

D-all of the above

Explanation:

The answer is D because....

  • Step one, It is not A Because although the statement is true it is not the best answer to fit the question. The soil does provide nutrients but it also does more, it provides temperature control, anchorage for the plant, and  the soil contains oxygen in it to help the plant grow.
  • Step two, lets look at B it provides them with water. Although this is true like A, it does more than provide them with water. It provides them a medium for growth.
  • Step three, So this answer is not correct because based on the option choices for option D all of the above is correct. It provides them a medium for growth to the plants likings.
  • Step four. This is correct because all of the above are true and best explain why soil is important to plants.
8 0
3 years ago
Read 2 more answers
What are the four main parts of a flower? _____.
Daniel [21]

Answer: pistil, stamen, sepal, petal

Explanation:

A flower consists of four main parts named pistil, stamen, sepal, petal.

- stamen produces pollen grains

- pistil receives the pollen

- petal & sepal are components of the flower

3 0
3 years ago
Read 2 more answers
Write a paragraph, using at least 4-6 sentences, that explains how and why the classification system has changed over time.
Marizza181 [45]

Answer:

they change over time based on newly gathered information, such as molecular information about a species. Organisms are now classified in a more specific manner which has ended up introducing so many new species of organisms.

Explanation:

7 0
3 years ago
Other questions:
  • Which process listed does not require oxygen be present? A. anaerobic respiration B. aerobic respiration C. ethyl alcohol fermen
    6·1 answer
  • During the g2 phase, the cell is preparing for mitosis. using your knowledge of cellular organelles and molecules, which molecul
    13·1 answer
  • What organism provides energy to the grasshopper? Which one provides energy to the hawk?
    14·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Elephants exhibit herding behavior. When they travel, the oldest and largest members often travel on the outer edges of the grou
    12·2 answers
  • Why is the cycle of natural disaster ➡ secondary succession an important and recurring process in ecosystems? (In other words, w
    14·1 answer
  • What is the external stimulus in thigmotropism?
    10·1 answer
  • 1. Explain how parents and offsprings can become different from eachother.
    13·1 answer
  • Which organelle triggers the destruction of skin cells responsible for the webbing of skin between the fingers and toes of a dev
    13·1 answer
  • Respiratory system, circulatory system, what stuck, digestive system, and how do they work together?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!