1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
agasfer [191]
4 years ago
11

Archaea and Eubacteria are kingdoms composed of organisms which:

Biology
1 answer:
alukav5142 [94]4 years ago
6 0
I think the answer is B do not have a membrane bound nucleus I'm not for sure

You might be interested in
What is the purpose of using genetic engineering to create edible vaccines?
Georgia [21]


A benefit of genetic engineering is the production of valuable proteins that have helped in managing of illness in human beings. Bacteria were genetically engineered to produce proteins of medical importance. One example of such a protein is human insulin which is given the name humulin and is made using E. coli bacteria.Earlier,  insulin from pig cells was used to treat patients with diabetes but many of them could not tolerate it because it has a slightly different arrangement of amino acids from that of humans and so the human body rejects it. Humulin is tolerated by the human body and so many patients are now using it to lead normal lives.
6 0
4 years ago
Read 2 more answers
______ function mainly in cellular movement
SCORPION-xisa [38]

Answer: Microtubules function mainly in cellular movement.

  • Microtubules are responsible for a variety of cell movements, including the intracellular transport and positioning of membrane vesicles and organelles, the separation of chromosomes at mitosis, and the beating of cilia and flagella.

  • Microtubules are filamentous intracellular structures that are responsible for various kinds of movements in all eukaryotic cells. Microtubules are involved in nucleic and cell division, organization of intracellular structure, and intracellular transport, as well as ciliary and flagellar motility.

7 0
3 years ago
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
Which statement best describes selective breeding?
Akimi4 [234]

Answer:

D. People allow only organisms with certain traits to reproduce.

7 0
3 years ago
Read 2 more answers
An organism has the following characteristics.
daser333 [38]
C domain eukarya kingdom animalia
4 0
3 years ago
Other questions:
  • Penicillin (an antibiotic that kills some bacteria) came into widespread use in the 1940s. by the 1990s, several different speci
    6·1 answer
  • How does human waste impact the water cycle?
    14·1 answer
  • Which key feature of living organisms is best described as the transmission of DNA from parent to offspring?
    12·1 answer
  • Select all that apply. Which of the following is true of vasodilators? Group of answer choices They alleviate edema. They increa
    5·1 answer
  • Miguel lives near Miami, Florida. His home receives electricity from the Turkey Point power plant which uses nuclear energy to p
    15·1 answer
  • The codon GAG becomes GTG due to a point mutation in the DNA, affecting the structure of the protein hemoglobin. What effect doe
    9·1 answer
  • Is a dead tree made up of cells
    13·1 answer
  • After the zygote is formed and cells become more specialized what process begins?
    12·1 answer
  • What objects did scientists use to help determine the age of the Earth? *
    7·1 answer
  • Does the digestive system functions well if the small intestine is being removed?​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!