I think that they will g<span>ain water in the distilled water and lose water in salty water. I think water will be lost because salt is used as an drying agent, it is why when it snow they will put salt on ice to keep the ice from being slippery because it dries things up. Distill just means to purify something.</span>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
movement to and fro or around something, especially that of fluid in a closed system.
The answer could be a fracture. Hope this helps!!
Answer:
The stem cells was discovered by Ernest McCulloch and James Till in 1981. Studies conducted for stem cells can be used for bone marrow transplantation and to treat various diseases.
Explanation:
Stem cell are the cells that has the ability to differentiate into different cells of the body. In 1978 human cord blood discovered as stem cell. The stem cell research come to known in 1981.
Ernest McCulloch and James Till discovered the stem cell research while working on the mice bone marrow. He found that the different blood cells were formed by the single class of cells.
Experiments on mice and other animals have been conducted to study the stem cells so far. The study of stem cell is useful to cure the genetic defects, Cancer and other harmful diseases.
