1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kramer
3 years ago
5

Many of the laboratory experiments that test the hypothesis that selection can produce evolutionary change have been performed w

ith Drosophila melanogaster, known by its common name the ___________.
Biology
1 answer:
IrinaVladis [17]3 years ago
7 0

Answer:

Fruit fly or vinegar fly.

You might be interested in
Which of the following terms refers to bloodstains that are not visible to the naked eye?
ANTONII [103]
The answer to your question 6loodstain Pattern Analysis
3 0
4 years ago
Read 2 more answers
What does the system of classifying things based first into broad categories, then into progressively more specific categories,
galben [10]

Answer:

Taxonomy

Explanation:

I just took it

7 0
3 years ago
Which conditions describe the neritic zone? check all that apply
klio [65]

Answer:

ample sunlight

steady nutrient supply

Explanation:

Neritic zine is the shallow end of deep water bodies.

This end receives stable temperatures of about 24 degrees celsius.

This area permits photosynthesis since light penetrates to the bottom, this is the reason why planktonic plants survive here.

The region has got steady salinity and because of its favourable nature, it has got many living organisms.

4 0
4 years ago
What are the limitations of the cell theory​
kicyunya [14]

Answer:

Explanation:

Viruses are a limitation to cell theory.

According to cell theory, all cells arise from pre - existing cells. But viruses lack any membranes and do not show the characteristics of life unless they enter a living body and use its cell machinery to multiply.

Hope this helps

plz mark as brainliest!!!!

8 0
3 years ago
Read 2 more answers
The two major volcanic regions are at the island arc and ring of fire. <br> True or False
lidiya [134]
True both the ring of fire and island arcs are places with a lot of volcanoes
8 0
3 years ago
Read 2 more answers
Other questions:
  • An excessive metabolic rate is caused by
    14·2 answers
  • Karie read the following definition of the term scientific method: "the series of steps that scientists use to answer questions
    6·2 answers
  • What part of an aquaponics system converts waste to fertilizer?
    15·2 answers
  • Why some plants may benefit more than others to certain variable
    11·1 answer
  • PLEASEEEEEEE HELPPPPPP
    6·1 answer
  • The rock cycle is defined as what?
    10·1 answer
  • Cellular respiration is a series of complicated reactions. Some of the enzymes that are necessary for the reactions to take plac
    10·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • How many ATP molecules are made with each glucose in the Krebs?
    10·2 answers
  • Can someone help me with this question
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!