1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Levart [38]
2 years ago
8

Which of the following is the correct sequence of events in the origin of life? I. Formation of protocells II. Synthesis of orga

nic monomers III. Synthesis of organic polymers IV. Formation of DNA-based genetic systems
Biology
2 answers:
vivado [14]2 years ago
7 0

Answer:

the order goes - ll,lll,l,lV

Explanation:

kirza4 [7]2 years ago
5 0

Answer:

II, III, I, IV

Explanation:

The correct sequence of events in the origin of life is

II.  Synthesis of organic monomers,

III. Synthesis of organic polymers,

I. Formation of protocells,

IV. Formation of DNA-based genetic systems.

monomers→polymers→protocells→ DNA-based genetic systems

You might be interested in
Which best describes the effect on weather in an area if low clouds cover the sky during the daytime?
kakasveta [241]

Answer:

Explanation:

jjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjj

7 0
3 years ago
What would be the chemical formula of a linear tetranucleotide that would have deoxyribose sugars and one of each of the possibl
tresset_1 [31]
The chemical formula would be
CTGA or any of the combinations of the four nitrogenous bases
The nucleotide is made up of four bases which makes it a tetranucleotide and the arrangement of each bases create a linear geometry.
5 0
3 years ago
Read 2 more answers
Can time exape a black whole?
antiseptic1488 [7]
No, nothing can escape a black whole not even light.
6 0
3 years ago
15. If a virus enters the lytic phase in a host's cell, it will cause the host cell to A. reject the virus. B. shrink because of
Anettt [7]

Answer:

B

Explanation:

The lyric phase is a six stage phase which include attachment, Penetration, transcription, biosynthesis , maturation and lysis

8 0
3 years ago
How does a termite benefit from microbes inside of their digestive system?
erastova [34]

Answer: Microbes in the hindgut of a termite break down cellulose into more easily digested sugars and short-chain fatty acids. These fatty acids are taken into the cells of the termite and used as nourishment in the same way human cells take in nutrients processed by our digestive system.

Explanation: I hope this helps

3 0
2 years ago
Read 2 more answers
Other questions:
  • What is the full meaning of dna
    11·2 answers
  • 25) when does the synaptonemal complex disappear?; a) late prophase of meiosis i; b) during fertilization or fusion of gametes;
    13·1 answer
  • What part of a cell prevents water from entering the cell?
    10·2 answers
  • If rainwater is always acidic, then what would its pH be?
    10·1 answer
  • Micropipettes and gene guns are mechanical vectors that introduce recombinant DNA directly into the cell’s
    10·2 answers
  • Human activities can alter earth’s natural cycles. true false
    12·2 answers
  • Cortical steroids are released by the adrenal glands. True or False
    5·1 answer
  • URGENT!!!!!!!!-What is the carrying capacity of the graph?<br> OPTIONS:<br> 4<br> 6<br> 13<br> 20
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • A ball falls off a building which has a height of 100 meters. It hits the
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!