1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
REY [17]
3 years ago
13

How do chloroplasts get energy from sunlight?

Biology
2 answers:
erastova [34]3 years ago
5 0

Plants are special in the manner that they possess the tendency to generate their own food with the help of energy they get from the sun. A component in the plants known as chloroplasts receives energy from the sunlight with the help of molecule chlorophyll. Chlorophyll along with certain other accessory pigments possesses the tendency to absorb a specific kind of wavelength of energy from the sun.

The molecule chlorophyll is located within the thylakoid. It has the tendency to absorb energy from the Sun, and it is also a specific pigment, which provides plants their green color.

Thus, the correct answer is chlorophyll and other pigments absorb energy from certain wavelengths of visible light.

cricket20 [7]3 years ago
4 0

Chlorophyll and other pigments absorb energy from certain wavelengths of visible light.

You might be interested in
Complete the following sentences.
djyliett [7]
1. The appearances of fireflies at dusk is an example of a circadian rhythm because it's happens daily. The correct option among all the options that are given in the question is the third option or option "c".

2. During migration, animals undertake a seasonal movement. The correct option among all the options that are given in the question is the first option or option "a".
7 0
3 years ago
Read 2 more answers
During the wettest period since they started keeping records in 1877, a 25 foot boulder fell in a mudslide and blocked both lane
ollegr [7]
The muddiness probably made the boulder slide and the strong cali winds 
7 0
3 years ago
In animals which process produces atp molecules
Firdavs [7]
Protein synthesis in the ribosomes
3 0
3 years ago
A flattened membrane sac inside the chloroplast used to convert light energy into chemical energy
algol [13]

Answer: D: Thylakoids

Explanation:

Thylakoids - A flattened, membranous sac inside a chloroplast. They often exist in stacks called grana that are interconnected; their membranes contain molecular "machinery" used to convert light energy to chemical energy.

***If you found my answer helpful, please give me the brainliest, please give a nice rating, and the thanks ( heart icon :) ***

6 0
3 years ago
Observations
Andrei [34K]

If I were you I would choose muscles it seems right to me although I might be wrong. Hope this helped some! ;)

3 0
3 years ago
Other questions:
  • incomplete dominance is seen in snapdragon. The allele that causes red flowers (F) is not completely dominant over the allele th
    12·2 answers
  • If calcium levels within a man’s blood drop too low it can result in twitching, depression, coma, or even death. Which character
    12·2 answers
  • Why does the northern hemisphere have summer in June
    11·1 answer
  • What is 6.9 × 107 written in standard form?
    14·1 answer
  • Which climates are subcategories of polar climates? Check all that apply.
    13·1 answer
  • Por qué en las adolescentes hay relación entre su ciclo sexual y la grasa corporal?
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Even though the tubers are genetically identical why the plants that grow from them may not be the same height ?
    11·1 answer
  • Which is the smallest particle of a macromolecule?<br><br> a. monomer <br> b. Polymer
    7·1 answer
  • 20.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!