1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mrac [35]
4 years ago
7

Why are there macromolecules considered to be organic?

Biology
1 answer:
denis-greek [22]4 years ago
6 0
I think they are called that because of the food we eat.
You might be interested in
Which of the following statements accurately describes the relationship between coral reefs and aquatic organisms?
asambeis [7]

The correct answer is - c. Coral reefs provide resources for aquatic organisms and derive resources from other organisms as well.

The corals are essential part of the marine ecosystems. They are feeding upon zooplankton, but also their polyps get sugar that is produced by the algae living on them. Also, the corals provide much needed shelter for lots of marine animals, but also are on the menu of some, like the starfish for example.

3 0
4 years ago
Read 2 more answers
Help please :)))))))
Mariana [72]

Answer:

C answer looks best

Explanation:

c C I think

6 0
3 years ago
Read 2 more answers
Using the following table what are food groups present in a chicken ? (Check ALL correct answers
Nimfa-mama [501]

Answer:

protein and fats is the answer

7 0
3 years ago
Read 2 more answers
Which type of precipitation is most likely to form during a thunderstorm?
Vanyuwa [196]

Hello.

The answer: Hail.

Have a nice day

6 0
3 years ago
Read 2 more answers
Which of the three particle diagrams represent a substance that consists of the highest thermal energy?
kondaur [170]

Diagram 1 represent a substance that consists of the highest thermal

energy.

<h3>What are Solids?</h3>

Solid is a state of matter which is characterized by the particles present

being tightly held together. Solids have a higher heat retention capacity  

as a result of the particles being very close to another.

This is the reason why solids are used as conductors of heat and

electricity for different purposes.

Read more about Solids here brainly.com/question/24613205

6 0
3 years ago
Other questions:
  • Changes in the gene pool can occur due to various mechanisms. From 1892 to 1954, millions of individuals emigrated (moved out) f
    12·2 answers
  • What reads the sequence of the mRNA? What are three nucleotides that code for an amino acid called?
    8·1 answer
  • Can anyone possibly have answers for these
    11·1 answer
  • Which of the following is NOT a function of the stem of a plant?
    8·1 answer
  • During a surgical procedure, the RN observes a surgeon wearing sterile gloves brush his posterior hand surface on a tray. The tr
    7·1 answer
  • Which tissue would likely have cells with the greatest number of gap junctions?
    13·2 answers
  • Which of these molecules' monomers is a series of nucleotides? *
    7·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Label the steps for protein synthesis in order, beginning with the first step.
    7·1 answer
  • . If this is true, can a person get rid of their excess fat by drinking more water?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!