1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jobisdone [24]
3 years ago
13

Which molecule sythesized by plants is a major source of engey for cellular processes in both plants and animals

Biology
2 answers:
JulsSmile [24]3 years ago
6 0
Could be nucleic acid. 

Vaselesa [24]3 years ago
6 0
The answer is C, glucose
You might be interested in
Which statement is best supported by the X-rays?
Anit [1.1K]
Animal Y is an invertebrate, animal Z is a vertebrate
8 0
3 years ago
Read 2 more answers
The essential nutrients Multiple Choice
photoshop1234 [79]

Answer:

4. cannot be made by the body and therefore must be consumed to maintain health.

Explanation:

Essential nutrients are nutrients that our body cannot synthesized and also those nutrients our body cannot produced in sufficient quantity, for the normal functioning of the body. These nutrients have to be obtained from the food we consume to support our life and health.

Essential nutrients obtained from food include carbohydrates, fats and oils, proteins, water, as well as certain vitamins and minerals. These essential nutrients that we get from our food are needed for good growth and development, prevention of diseases, as well as for maintaining good health.

3 0
3 years ago
What acidic and basic substances do you encounter in your everyday life activities?
nataly862011 [7]
Acidic fruits milk
Basic soap
5 0
4 years ago
For accuracy and clarity, the initial point of reference for body regions or parts is anatomic position. An individual is in thi
fgiga [73]

This should be the answer.

  1. Head
  2. UP,
  3. STRAIGHT
  4. ERECT,
  5. UP
  6. Looking forward.

<h3>What is the anatomic position?</h3>

The anatomic position refers to the position in which a person is standing upright facing the observer, feet parallel and flat on the floor, and palms facing forward. The upper limbs are at the body’s sides with the palms facing forward.

Thus, this could be the answer.

To learn more about  anatomic position click here:

brainly.com/question/19261448

#SPJ1

7 0
2 years ago
After gram staining your unknown bacteria, you look through the microscope and observe that your bacteria is circular shaped and
Maslowich
<span>Staphylococcus = "staphylo" meaning clusters and "cocci" meaning circular</span>
6 0
3 years ago
Other questions:
  • G why are glucose ketone bodies or protein not normally detected in urine
    14·1 answer
  • The salivation of dogs in pavlov’s experiments was significant because it ____.
    13·2 answers
  • Scientific reasoning requires a circular way of thinking based on gathering and evaluating evidence.
    11·1 answer
  • Why do scientists think that birds evolved from dinosaurs?
    15·2 answers
  • 5. Circle the letter of each sentence that is true about the production of
    12·1 answer
  • In a genetic cross between two flowering plants that are heterozygous for the color trait, red flowers (R) are dominant to white
    11·1 answer
  • The blood carries _________________ to the cells from the lungs, and then picks up the _____________________ waste to carry back
    14·1 answer
  • Look at the science supplies.
    11·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • North Carolina has more wind off its shore than any other Atlantic Coast state. How could this resource be best utilized to redu
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!