1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mestny [16]
3 years ago
5

The term ______ refers to an organism's ability to survive and produce fertile offspring.

Biology
1 answer:
LUCKY_DIMON [66]3 years ago
6 0
The term is Fitnesss
You might be interested in
Question 7 of 34
alexandr1967 [171]

Answer:

B. Excretory system

Explanation:

<em>Because the excretory system is made to remove urine which consists of waste materials such as excess salts and water. The kidneys are present in it as well. If there is too much water in the body the excretory system will produce urine with higher water concentration so whiteish urine will be produced and if there is a low amount of water in the body the excretory system will produce urine with lower water concentration so yelloish or greenish urine will be produced</em>

5 0
2 years ago
PLEASE HELP , WILL GIVE BRAINLIEST. In Mendel’s first experiment, he crossed tall plants with short plants and found tall plants
Flura [38]
Make a box with four sections and put TT Tt TT Tt above them I think
8 0
3 years ago
10. What processes found at hot spots will help form the following rocks? (4 points)
SSSSS [86.1K]

Answer:

metamorphic rock

Explanation:

metamorphic rock simply means that the rocks have been geophysically altered. heat is always a primary source for alteratino of rock so the heat ofmolten rock generated by hot spots can easily cause an abundance of metamorphic rocks within the system

8 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
What happened when two forces act in the same direction
Helga [31]

Answer:

They repel one another. I think

4 0
3 years ago
Read 2 more answers
Other questions:
  • After population growth, what does the United Nations believe will be the greatest future global pattern?
    12·2 answers
  • When are scientific claims accepted? And when are they questioned and/or rejected?
    15·1 answer
  • Which of the below is a limitation of the biological species concept?
    6·1 answer
  • In a flowering plant, gene "A" encodes an enzyme responsible for the presence of dots on the flowers’ petals. A1, A2, and A3are
    10·1 answer
  • Which list correctly aligns the levels of organisms from the least to the most complex?
    11·2 answers
  • Humans are having more of a negative impact on Earth in recent years. <br>​
    15·1 answer
  • How can a hunter help wildlife conservation efforts? A, By making sure to always obey the rules of firearm safety By making sure
    11·2 answers
  • PLEASE HELP ILL GIVE BRAINIEST
    10·1 answer
  • Place the levels of an ecosystem in the correct order from smallest to largest
    9·1 answer
  • PLEASE HELP:
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!