1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
evablogger [386]
4 years ago
13

PLEASE HELP I WILL GIVE 99 POINTS

Mathematics
2 answers:
Keith_Richards [23]4 years ago
6 0
Aida did not correctly divide by the common factor to get (4+8)
Juli2301 [7.4K]4 years ago
4 0
Aida did not correctly divide by the common factor to get (4+8).
You might be interested in
WILL WIN BRAINLIEST!! Write a word problem that could be represented and solved by the equation 12C = 72.
nikitadnepr [17]

Answer:

Bella wants to buy as many birthday card as possible with 72 dollars. If each card costs 12 dollars, how many cards can she buy?

Step-by-step explanation:

7 0
3 years ago
Read 2 more answers
1) Use the Euclidean Algorithm to nd the greatest common divisor of 71407 and 2020. (Write down all of the steps, so that you ar
Olenka [21]

Answer:

Step-by-step explanation:

We have

71407 = 2000(35)+1407\\2000 = 1407+1(593)\\1407= 2(593) + 221\\593 = 2(221) = 151\\221=151+70\\151=2(70)+11\\70 = 6(11)+4\\11=2(4)+3\\4 = 3+1\\3 = 3(1)+0\\

So we find GCD = 1

2) By back substitution we get

71407 (543) - 19387(2000) =1

So x = 543 and y = -19387

Because we got 71407 (543) - 19387(2000) =1

y cannot be positive

y can only be negative

8 0
3 years ago
Brock is a plumber. He charges a flat rate of $40 to visit a house to inspect it's plumbing. He charges an additional $20 for ev
Rina8888 [55]

where are the graphs?


3 0
3 years ago
Read 2 more answers
Mark’s salary is $900 per month. What is his yearly salary? $
velikii [3]
His yearly salary is 10,800
6 0
4 years ago
Read 2 more answers
One number is 876.2 more than twice the other. If the sum of the two numbers is 2005.46, find the larger of the two numbers?
kirza4 [7]

Answer:

these .56 because they are bigger

Step-by-step explanation:

hope this helps

4 0
2 years ago
Other questions:
  • there are 500 hundred pages. if the book has 25 chapters and each chapter is 20 pages long. what is the chance that of randomly
    7·1 answer
  • (8x^3-6x)-(10x^3+3x^2-x)
    13·1 answer
  • Use the given conditions to write an equation for the line in slope-intercept form.
    7·1 answer
  • Solve -3+2ln(x)=0<br><br><br> .......
    6·1 answer
  • Which numbers are rational? select all that apply. A. pi B. √50 C. 2.3 D. √144
    12·2 answers
  • Whats the answer to x - 7 = 12
    10·2 answers
  • Charolette bought packages of hotdogs for $4 each. Each package contains 8 hot dogs.If she spent $16 on hot dogs how many hot do
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What’s the slope of the line?
    15·1 answer
  • If mp is p , price including VAT is q, discount amount is r and VAT amount is s ,then find the relation between them
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!