1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
taurus [48]
3 years ago
5

Will mark brainliest (:

Biology
1 answer:
Levart [38]3 years ago
8 0

Answer:

The answer is D

Chromosomes contain genes, and genes are made of DNA.

You might be interested in
Evaluate A red-flowered plant was crossed with a white-flowered variation of the plant. All of the flowers on the next generatio
Nostrana [21]
The white-flowered variation of the plant was recessive while the red-flowered variation was dominant.
6 0
4 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
The phases of the moon depend on how much of the lighted side of the moon can be seen from Earth
Zanzabum

TRUE because the earth and moon are always rotating, therefore we see different parts based on where we are at.

5 0
4 years ago
Read 2 more answers
what is the name of the process where the RNA code is changed into an amigo acid sequence and where in the cell does this proces
kvv77 [185]

they change in the ribosomes

7 0
4 years ago
What is diffussion ?<br>Defines osmosis?<br>what is hypotonic solution?​
frozen [14]

Answer:

Diffusion is the net movement of anything from a region of higher concentration to a region of lower concentration. Diffusion is driven by a gradient in concentration. The concept of diffusion is widely used in many fields, including physics, chemistry, biology, sociology, economics, and finance.

Dictionary

Definitions from Oxford Languages

Search for a word

osmosis

/ɒzˈməʊsɪs/

Learn to pronounce

noun

1.

BIOLOGY•CHEMISTRY

a process by which molecules of a solvent tend to pass through a semipermeable membrane from a less concentrated solution into a more concentrated one.

2.

the process of gradual or unconscious assimilation of ideas, knowledge, etc.

A hypotonic solution has a lower concentration of solutes than another solution. In biology, a solution outside of a cell is called hypotonic if it has a lower concentration of solutes relative to the cytosol. Due to osmotic pressure, water diffuses into the cell, and the cell often appears turgid, or bloated.

6 0
3 years ago
Other questions:
  • What are virus made of
    15·1 answer
  • Autotroph is to producer as heterotroph is...
    9·2 answers
  • Which is an example of a biotic factor that would limit the size of a deer herd?
    9·1 answer
  • An ecological pyramid is sometimes used to show both the flow of matter and energy in an ecosystem. The pyramid narrows as matte
    10·2 answers
  • What prevents the plant cell from constricting in the center during telophase?
    9·1 answer
  • The process of heat transfer thought to be responsible for the movement of the lithospheric plates on the surface of the earth i
    9·2 answers
  • What is the answer of the question?
    13·1 answer
  • Discuss how the properties of water help Earth support life.
    10·1 answer
  • 5 questions :
    11·1 answer
  • 1. What happens to a plant that is put into a dark place? The plant's green color fades because it cannot perform photosynthesis
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!