1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zepelin [54]
4 years ago
12

A hydrolysis reaction is best described as a chemical reaction in which a) water molecules are added. b) water molecules are rem

oved. c) water molecules change places. d) a reactant becomes wetter to the touch.
Biology
1 answer:
Scorpion4ik [409]4 years ago
3 0

Answer:

a) water molecules are added.

Explanation:

In hydrolysis, a water molecule is added to a substance. Sometimes, this reaction causes the water molecule and the substance to split into 2 parts. In such a reaction, a part of a molecule of the substance gains a hydrogen ion, which breaks down the chemical bond between the constituent particles of the molecule.

You might be interested in
How does compaction lead to lithification
Reptile [31]

Answer: ok its becase

Explanation:

Lithification is the process by which sediments combine to form sedimentary rocks. Compaction is a consolidation of sediments due to the intense pressing weight of overlying deposits. With compaction, sediment grains get squished together, reducing the size of the original pore space that divided them.

Hope it helps and can i get brianlest

7 0
3 years ago
At a specific area of a chromosome, the sequence of nucleotides below is present where the chain opens to form a replication for
sattari [20]

Answer:

The correct answer is the D option 5' A C G U U A G G 3'

Explanation:

The chemical ending orientation of a single strand of nucleic acid into a single strand of DNA or RNA is the chemical convention of naming carbon atoms in the nucleotide sugar-ring,

It means that there will be a 5′-end (usually pronounced "five prime end" ), which frequently contains a phosphate group attached to the 5′ carbon of the ribose ring, and a 3′-end (usually pronounced "three prime end"), which typically is unmodified from the ribose -OH substituent.

8 0
3 years ago
A. vaporization<br><br> b. freezing<br><br> c. condensation<br><br> d. melting
Studentka2010 [4]

your answer will be C


8 0
3 years ago
Why should a scientist use a plasmid with a GFP gene when inserting a new gene?
azamat

Answer:

the answer is a

Explanation:

the GFP gene will make cells glow green in ultraviolet lights, confirming that the gene intersection worked.

8 0
2 years ago
Please answer all of those questions in the photo
olganol [36]

Answer:

um....if you got the passage how we spposed to tell you.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • What makes ribosomal RNA useful as a molecular clock?
    6·1 answer
  • Johnny's teacher asked him to explain how to make a wet-mount slide to the rest of the class. Here is Johnny's response: "Well
    9·1 answer
  • Large mats of green algae lived during the __________ period, more than 550 million years ago .
    12·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Binary fission produces __________. see section 8.2 (page 180) . binary fission produces __________. see section 8.2 (page 180)
    9·1 answer
  • true or false : the oxygen and carbon in a carbon dioxide molecule cannot be separated once the bonds have been formed between a
    13·1 answer
  • He parizkova studies indicate that physical activity has a ___________ influence on boys' body composition during the growing ye
    7·1 answer
  • How might some protists with mitochondria have evolved
    11·1 answer
  • In humans, being a tongue roller (R) is dominant over non-roller (1). A man who is a non-roller marries a woman who is heterozyg
    14·1 answer
  • Which BEST describes the process of photosynthesis? A a process of energy conversion that releases energy from food in the prese
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!