Answer:
The correct answer is b.Amplify the gene using PCR. Insert the gene into a plasmid vector. Transform the vector into the bacteria.
Explanation:
If I have a very small amount of gene for a fluorescent protein than the first step is to amplify the gene so that appropriate protein can be produced. PCR is the instrument that is used to amplify the protein.
So after amplification of the gene, the plasmid vector will be used in which the gene will be inserted because the plasmid vector is used to insert this gene in host cells where protein will be expressed.
The final step will be to transform bacteria with recombinant plasmid so that plasmid can make its copy and express a fluorescent protein in bulk.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Hi Patinjordan,
mRNA has codons, each made up of 3 bases, which code for a particular amino acid.
-AS