1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
grandymaker [24]
3 years ago
7

Which feature is found in prokaryotic cells but not in eukaryotic cells? A. nucleus B. plasma membrane C. nucleoid D. cytoplasm

Biology
2 answers:
Ronch [10]3 years ago
6 0
The answer is A. - Prokatyotic cells lack a defined nucleus while eukaryotic cells do have one :) I loved learning about the cells in biology! But I noticed your question is worded a little differently so the nucleus would be the one thing a eukaryotic cell has that a prokatyotic cell does not...
Leviafan [203]3 years ago
3 0
If the question is, which feature is found in eukaryotic cells but not in prokaryotic cells, then the answer is A. nucleus ( as prokaryotes lack a well defined nucleus).
You might be interested in
Which one goes to the right one
-BARSIC- [3]
U still have school its summer
4 0
3 years ago
Help please! Will give brainliest.
Serggg [28]

Answer:

the diagram shows the body structures that are similar though in different species due to common ancestry, this evidence is comparative anatomy.

8 0
3 years ago
Read 2 more answers
Select which of the following are mechanisms used by pathogens to avoid host defenses and to successfully colonize the host.
matrenka [14]

Answer:

Producing toxic substances to suppress host response

6 0
3 years ago
(20 POINTS + BRAINLIEST) What polysaccharide provides rigidity and strength in plants?
Scorpion4ik [409]

I believe it would be C) Cellulose. As this is one of the essential components found in the cell wall of plant cells.

6 0
2 years ago
Read 2 more answers
Antibodies start the inflammatory response. True or False?????????
yaroslaw [1]

Answer:

True

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Discuss how protein kinases function to produce signal amplification in a cell
    9·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Make a lengthy note on AEROBIC and ANA-AEROBIC respiration,include equations where necessary and feel free to add pictures. Plea
    7·1 answer
  • Why can an exogenous protein, protein that is added by experimentalists that has the same amino acid sequence as endogenous prot
    12·1 answer
  • How are matter and nutrients cycled back into the ecosystem from which they came?
    9·1 answer
  • How<br> might a sinus infection affect the rest of the respiratory system?
    7·1 answer
  • Human activity in the Mojave desert impacts the balance of the ecosystem.<br> A. True<br> B. False
    8·2 answers
  • Latency refers to ;the process of viral replication inside a host. the process of making a viral envelope from portions of the h
    11·1 answer
  • Can someone please help me and please no links
    6·1 answer
  • How does energy from a top level consumer get recycled back into the pyramid?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!