How are minerals classified, and what common characteristics do major minerals share nutritionally?

1 answer:

5 0

How they’re classified:

There are two main classifications of minerals major minerals are minerals your body needs in relatively large quantities and trace minerals are minerals your body needs in relatively small quantities major minerals include sodium,potassium, chloride, calcium, phosphorus, magnesium, and sulfur

What they share nutritionally:

They’re solid, inorganic, naturally occurring, and have a definite chemical composition and crystalline structure

You might be interested in

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

The downward movement of a block of material along a curved surface is called a

slavikrds [6]

It’s called a slump
Hope this helps :)

7 0

4 years ago

A chlorine atom that has 17 protons and 18 neutrons is calls

Westkost [7]

This is a neutral atom of chlorine.

8 0

3 years ago

A new strain of rice was developed to be resistant to popular weed killers. What could be a negative outcome from the production

asambeis [7]

B. Because of Farm laws that require no seeds to be kept from a harvest, or you are not allowed to have plants of a different genetic make or made by a different company in your field if you didn't buy it, you could have wind carry seeds into opposing fields, and if inspected, you would potentially have to pay a fine for having unauthorized varieties growing in your field. And trying to remove it would be a pain, because you would either have to find a killer that your plants are resistant to, or to find these individually and pluck them, or to spray a killer that would kill all of your plants, but none of these resistant varieties

7 0

3 years ago

Read 2 more answers

Peppered moths come in two colors, black and white. What did Kettlewell show, with regard to peppered moth populations and tree

jarptica [38.1K]

In smoggy areas dark moths have the most higher survival rate than white moths in this question so its going to be (A)

3 0

3 years ago

Read 2 more answers