1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
3 years ago
6

Summarize the process of photosynthesis in your own words. Be sure to describe both light and dark reactions.

Biology
1 answer:
Burka [1]3 years ago
5 0

Photosynthesis is the process by which green plants absorb light energy from the sun with the assistance of water and carbon dioxide, and transform it into chemical energy to make (synthesize) carbohydrate (specifically glucose) and oxygen.

The "light-independent" or dark reactions happen in the stroma of the chloroplasts. This is also known as the Calvin Cycle. Since these processes can only happen in the chloroplast (a chlorophyll filled plastid in green plants), photosynthesis can only happen in green plants!

The first overall principle of photosynthesis is that the light energy from the sun is transformed into chemical energy and stored in the bonds of glucose (the sugar carbohydrate) for later use by the plant and/or organism that eats the plant.

The second overall principle of photosynthesis is that carbon, oxygen, and hydrogen atoms are taken from carbon dioxide and water molecules and are broken up and rearranged into new substances: carbohydrate (specifically glucose) and oxygen gas (so we can breathe, whew!). This reaction represents the transfer of matter: carbon dioxide from the atmosphere, water from the soil or atmosphere, into sugar in the plant and oxygen back into the atmosphere.

Light-Dependent Reactions

The first part of the process happens in the thylakoids of the chloroplasts and are the "light-dependent" reactions: The photosystems I and II absorb the photons from the sunlight and process them through the membranes of the thylakoids simultaneously. The photons excite electrons in the chlorphyll which then move through the electron transport chain and causes NADP- to combine with H+ forming NADPH. At the same time, ADP (adenosine diphosphate) has come from the dark reaction and a third phosphate chain is bonded forming ATP (adenosine triphosphate) to feed the Calvin Cycle next. Remember that ATP is the important source of all cellular energy.

We now believe that all the oxygen released in photosynthesis comes from the water molecules and all oxygen atoms that form the carbohydrates come from the carbon dioxide molecules. So, in other words during the light-dependent reaction a water molecule is broken down producing two H+ ions and half an oxygen molecule. We get the rest of the oxygen molecule when another water molecule is broken down.

Dark Reactions

Dark reactions are also known as the Calvin Cycle, the Calvin-Benson cycle, and light-independent reactions. The point is that they do not require sunlight to complete their process.

After ATP is formed in the first part of photosynthesis, for living things to grow, reproduce and repair themselves, the inorganic form of CO2 must be transformed into carbohydrate. This happens during the Calvin Cycle in the stroma (the fluid filled interior of the chloroplast). ATP and NADPH combine with CO2 and water to make the end product of glucose. The ADP and NADPH+ are recycled to the light-dependent side to start the process over.

Remember that during hours of darkness, plants cannot perform photosynthesis so they do cellular respiration in the mitochondria just as all living organisms do.

You might be interested in
What is true of loam?
nekit [7.7K]

Answer:

D

Explanation:

True loam is not just any old topsoil. Technically, it has a certain texture, based on the size of its particles, clay being fine-textured, sand being coarse, and silt in between.

5 0
3 years ago
Read 2 more answers
What is weathering - For science
jeka57 [31]

Answer:

Weathering is the breaking down of rock

Explanation:

Pls mark it as brainlest

7 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
A moon phase that looks like a half-circle from Earth *
Archy [21]
<h2><em>C</em><em>.</em><em> </em><em>Quarter</em><em> </em><em>moon</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em></h2>

6 0
2 years ago
You are part of a desert plant research team trying to discover crops that will be productive in arid climates. you discover a p
serg [7]
<span>The hormone which is being produced under a water-deficit condition which triggers a drought response is known as Abscisic Acid or ABA.

Abscisic acid is termed as a plant hormone. The main functions in the development of plants include
1. Stomatal closure.
2. Control of organ size.
3. Bud dormancy.
It responds to environmental stresses in plants, which include heat stress, freezing tolerance, cold tolerance, soil salinity, and drought.</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following places would you expect to visit on a beach vacation?
    6·1 answer
  • Which of the following is the best way to pick up a small dog that weighs approximately 10 pounds?
    10·1 answer
  • •Address the letter to the editor of a local newspaper.
    14·1 answer
  • Based on the information in the graph, which blood type is most likely to be in shortest supply during an emergency?
    10·2 answers
  • Where does DNA unwinding begin?
    13·1 answer
  • Which describes a population depending on an abiotic factor?
    7·1 answer
  • Which of the following would most likely be found in a wide valley
    14·1 answer
  • How do temperature and salinity affect deepwater currents?
    8·2 answers
  • NEED HELP ASAP!! WILL MAKE BRAINLIEST - 25 POINTS
    5·1 answer
  • 2. What are the modes of asexual reproduction in Porifera?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!