All categories

3 years ago

Which climates are subcategories of polar climates? Check all that apply.

Biology

1 answer:

elixir [45]3 years ago

6 0

Answer:

Option A and B

Explanation:

Polar climates are of two types namely -

a) tundra - This is also known as ET climate. Tundra climate has at least one month out of the 12 months in a year in which the average temperature is lower than zero degree celcius

b) ice cap- This is also known as EF climate . In this climate, all the moths with in a year have average temperature lower than zero degree

Option A and B is correct

You might be interested in

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

Accidental post oops.

LuckyWell [14K]

Answer:

SORRYΩ

Explanation:

SORRYΩ

7 0

3 years ago

UCU-CGA-GCC-GUU-GGG-UGA how do I convert this into an amino acid using the codon chart, i've been on this forever

bulgar [2K]

So u get a codon chart it'll look like a circle with a bunch of letters. Then you use the letters u are given for every dash such as UCU and you go biggest to smallest letter until you hit an amino acid or stop then what you write down is that amino acid you hit. For an example, we'll use UCU. You go to the big letter U inside that big U will be a smaller C and inside that C will be a smaller U which leads to an amino acid or a stop codon. And you do this with every group of 3 letters. If one is missing it stops prematurely and if there is an extra when it may have a mutation. I hope that helped! If not there are YouTube videos out there that can help.

7 0

3 years ago

Solve & Explain...WILL GIVE BRAINLEST AND POINTS

Furkat [3]

B. an atom

Atoms are the basic units of matter and the defining structure of elements.

8 0

3 years ago

Why can a trait seem to be hidden, but is actually there?

irina1246 [14]

Answer:

However, an allele that is hidden, or not expressed by an organism, can still ... A trait in one generation can be inherited, but not outwardly apparent before ... of the offspring from a cross where the parents differ by only one trait will appear identical.

Explanation:

6 0

3 years ago