1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Volgvan
3 years ago
8

What are the organisms that make their own organic compounds needed for life functions called?

Biology
2 answers:
matrenka [14]3 years ago
5 0
<span>  i think it si called an autotroph?</span>
g100num [7]3 years ago
5 0
<h2>ANSWER:</h2>

Autotrophs.

<h2>EXPLANATION:</h2>

An autotroph is an organism that can generate its own food utilizing light, water, carbon dioxide, or other chemicals. since autotrophs create their own food, they are also known as producers. Plants are the common simplistic type of autotroph, but there are many several kinds of autotrophic organisms.

You might be interested in
How does your heart rate affect the rate at which red blood cells travel throughout your body? PLEASE HELP ME QUICK!!
kiruha [24]

Answer:

with each heartbeat,the heart pumps blood throughout our bodies,carrying oxygen to every cell,after delivering oxygen the blood returns to the heart the heart then sends the blood to the lungs to pick up more oxygen.

4 0
3 years ago
The __________ are formed in red bone marrow and then migrate to tissues throughout the body. these blood cells destroy parasiti
docker41 [41]

Answer:

Eosinophils

Explanation:

These are type of White blood cells W.B.C ,present almost 2% of white cells . About twice the size of red blood cells , Nucleus is bi lobed . They are often used for parasite attack , Inactivate inflammation and production of substances .

4 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Many protists can move. what are some structures mentioned that can help protists move.
Ksivusya [100]

Answer:

cilli and flagella

Explanation:

I think there is one more but not sure hope this helped

(also if spelling is weird sorry I tried)

6 0
2 years ago
what type of behavior is a caterpillar building a cocoon? A. instinct B. imprinting C. conditioning D. insight learning
Ratling [72]
I believe it is <u>instinct </u>that is the behavior of the caterpillar building a cocoon.
7 0
3 years ago
Other questions:
  • Carbohydrates and proteins are two types of macromolecules. which functional characteristic of proteins distinguishes them from
    13·1 answer
  • The formula v2 = G is very useful for astronomers because it does not require them to know T. What does T stand for? orbital per
    15·2 answers
  • The structure that results when atoms are joined together by covalent bonds is called a(an) . molecule
    10·1 answer
  • The discipline that applies ecological principles to returning degraded ecosystems to a more natural state is known as
    8·1 answer
  • Which statement is false? A. Every integer is also an irrational number. B. Every integer is also a real number. C. No irrationa
    9·2 answers
  • Over the past century, several scientists around the world have made the following observations:
    9·1 answer
  • What statement is true of Y chromosomes
    9·1 answer
  • How do scientists use global seismology data as evidence of plate tectonic movements?
    14·1 answer
  • If 32% of a DNA molecule consists of thymine, what percentage must there be of the other bases? Show calculations or explain you
    14·1 answer
  • A chloroplast is releasing large amounts of oxygen. What does this tell you about what other processes are going on inside the c
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!