1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erastova [34]
2 years ago
12

Use the words to label the white blood cell

Biology
2 answers:
alexgriva [62]2 years ago
7 0
Your answer is located here

Daniel [21]2 years ago
6 0

Answer:

White blood cells are the cells which play an important role in providing immunity to the body.  The WBC can be categorized into five types which perform distinct functions in immunological response.

In the given question, since the WBC is engulfing the bacteria particle by the process of phagocytosis. The WBC contains cytoplasm and bilobed nucleus, therefore, this could be wither a neutrophil or eosinophil.

You might be interested in
What is the name of the process of RNA formation from DNA?
Komok [63]
The process of RNA formation from DNA is transcription. 
6 0
3 years ago
Read 2 more answers
How does the decrease of predators and increase of food make the elk population increase? Please explain
damaskus [11]
The decrease of predators would make the elk population thrive, because there would be nothing to hunt them down. And with an increase of food, the elks would have enough to eat therefore the elks would not die from hunger.
7 0
2 years ago
Read 2 more answers
Organic compounds are used as building blocks for *
Orlov [11]

Answer: Organic compounds are used as building blocks for  water, DNA, and starches   water, proteins, and oxygen   proteins, DNA, and carbon dioxide   proteins, starches, and fats

water, DNA, and starches

water, proteins, and oxygen

proteins, DNA, and carbon dioxide

proteins, starches, and fats

Explanation:

3 0
3 years ago
The process that removes metabolic waste products from an organism is known as
Likurg_2 [28]
I think the answer to this would be Excretory Process.
4 0
3 years ago
When a person removes co2 from the lungs by exhaling, the person also removes __________ from the blood?
aliina [53]
I think the correct term would be carbon dioxide. When a person removes co2 from the lungs by exhaling, the person also removes carbon dioxide from the blood. As the blood flows in the lungs, carbon dioxide would pass out from the blood and by diffusion to the alveoli. Then, by exhaling it is removed from the the lungs.
8 0
3 years ago
Other questions:
  • Select all that apply. Which of the following countries exclusively use the metric system? United States France England Canada
    14·2 answers
  • The A and B antigens in humans may be found in water-soluble form in secretions, including saliva, of some individuals (Se/Se an
    9·1 answer
  • WILL GIVE BRAINLIEST !!
    8·2 answers
  • What is the function of the Type II alveolar cell?
    14·1 answer
  • Use the information from the article to answer the question.
    6·2 answers
  • sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
    7·1 answer
  • What do you think about this picture?​
    14·1 answer
  • A research biologist is studying cells from a new organism recently discovered in the Brazilian rain forest. She determines that
    13·1 answer
  • Can someone help me in this food web lab assignment.
    5·1 answer
  • PLEASEEEE HELPPP ASAPPPP :))
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!