Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Chromosomes makes up genes while genes and chromosomes make up the entirety of DNA. A living organism inherits 46 chromosomes, 23 from each parent. These chromosomes are not genes but they form genes, which are just the traits of an individual that are unique. DNA is the entire make up of an organism that controls everything about a person such as likelihood to have disease or their physical appearance.
please vote my answer brainliest. thanks!
Its compares its self to its parent because its an exact copy of the genes... They are essentually twins.....
convergent evolution - called analogy
a potential source of confusion in constructing a phylogeny is similarity between organisms that is due to convergent evolution - called analogy - rather than to shared ancestry. thus for mammals, the backbone is a shared ancestral character, a character that originated in an ancestor of the taxon
Answer:
i am pretty sure its indicator
