1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vagabundo [1.1K]
3 years ago
5

A person who is homozygous for the x chromosome is

Biology
1 answer:
xxMikexx [17]3 years ago
7 0
A person who is homozygous for the X chromosome is female.
Women have two X chromosomes, which means they are homozygous for the X chromosome - the word homozygous means that they have 'two chromosomes of the same kind.' Men have different types of chromosomes - XY. 

You might be interested in
We often hear people talk about family traits and how they seem to skip a generation, according to Mendel what has happened?
Vesnalui [34]
This family trait that skips a generation comes from an autosomal recessive trait or as Mendel called as hidden non-dominant trait. Offsprings have a dominant and recessive trait which comes from both parents. Recessive trait appears only when two offspring with same recessive trait blends. This happens in self-fertilization. In the human population, marriage is prohibited between offsprings, thus having recessive trait is only imminent when cousins are married.
3 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Producers can use energy from the sun to produce food for themselves through a process called...?
Thepotemich [5.8K]

photosynthesis is the process that producers go through to make food using sunlight.

5 0
3 years ago
The structures through which gaseous exchange takes place
eimsori [14]

The function of the respiratory system is to exchange two gases: oxygen and carbon dioxide.


Hope this helps :)

6 0
3 years ago
Why is important for scientists to use scientific names and not common names?
klemol [59]
It is important for scientists to use scientific names and not common names because common names can be easily misunderstood as something else. For example, a scientist during an expeirement will use scientific names because if they used a common name of a certain thing and it be mistaken for something that it wasn't the entire expeirement would be ruined or someone could get hurt.
5 0
3 years ago
Other questions:
  • What is the chemical composition of chromatin?
    8·2 answers
  • What is it important that carbon is recycled?
    7·1 answer
  • When cardiac muscle cells are damaged by a heart attack, they are usually replaced by new cardiac muscle cells. new smooth muscl
    6·2 answers
  • Rigor mortis that occurs in skeletal muscles a few hours after death is due to
    12·1 answer
  • Which statement best describes a contribution that decomposers make to an
    15·2 answers
  • Which part of the eye is the opening through which light initially passes?
    6·1 answer
  • I learned about oral sex from school..can you can get an STD just from talking about sex? IM SCARED PLS RESPOND
    6·1 answer
  • Which plant does not contain a nucleus
    6·2 answers
  • Which type of population pyramid occurs in locations where fertility rates are high, death rates fall, and more people
    5·2 answers
  • A. Crossing over decreases genetic diversity
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!