1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fiesta28 [93]
3 years ago
11

In his study of pea plants, Gregor Mendel used which method to produce offspring?

Biology
1 answer:
Ivanshal [37]3 years ago
4 0
Gregor Mendel used Cross-pollination method to produce offspring.
You might be interested in
What energy yield (in molecules of ATPATP per molecule of monosaccharide) would you predict for the bacterial catabolism of raff
Katena32 [7]

Answer:

The correct answer is 2.67 ATP per molecule.

Explanation:

With the help of sucrose, it comes to known that the dissociation of a sugar-sugar bond generates one phosphorylated monosaccharide. Therefore, raffinose, which is a trisaccharide exhibits bonds of two sugar-sugar molecules. Post dissociation, they will generate one regular monosaccharide and two phosphorylated monosaccharides.  

There will be the generation of net ATPs by each phosphorylated monosaccharide as they are already phosphorylated. While the regular monosaccharide, which is first needed to get phosphorylated will only produce two ATPs. Thus, a total of 8 ATPs will be produced by one molecule of raffinose. After dividing by three monosaccharides, the molecule will produce 8/3 = 2.67 ATPs per monosaccharide.  

5 0
3 years ago
The difference between the meanings of combining forms spondyl/o and vertebr/o is
masha68 [24]
The difference between the meanings of combining forms spondyl/o and vertebr/o is spondyl/o and vertebr/o both mean vertebra. There is no difference because they are both vertebra.
Spondyl/o is a combining form meaning vertebrae. The two combining forms for vertebrae bones of the spine, are vertebr/o and spondyl/o.
3 0
3 years ago
Please help<br> Will put brainiest
satela [25.4K]
The answer is c....!!!!!
8 0
3 years ago
Animals that advertise their poisonous or dangerous qualities use a defense called ________ mimicry.
astraxan [27]
The correct answer is Batesian. Animals that advertise their poisonous or dangerous qualities use a defense is called Batesian mimicry. Batesian is basically a mimicry form that a harmless species evolved into some warning for a harmful one directly on the predators.
7 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • Which is an appendicular bone? Apex<br><br> A) Cranium<br> B) Tarsal<br> C) Rib<br> D) Vertebra
    13·2 answers
  • Of all the members of the vitamin e family, only ________ is maintained in the body and can meet the body's needs for the vitami
    14·2 answers
  • Adult female monkeys from one population breed with male monkeys of a nearby population. The introduction of new alleles into th
    6·2 answers
  • Precipitation occurs when
    5·1 answer
  • Which best describes the role of auxin?
    7·2 answers
  • Endorphins will ______________.
    11·2 answers
  • What does Na+ represent? Select all that apply.
    10·1 answer
  • When it is summer in New York what is it in South Africa
    9·1 answer
  • What is positive feedback loop is also know as
    12·2 answers
  • The nitrogen cycle describes how nitrogen is converted between different forms. Describe the nitrogen cycle process by completin
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!