1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tems11 [23]
3 years ago
12

Analogy of Cell wall

Biology
1 answer:
swat323 years ago
4 0

Answer:

In school, I was taught that it is like a bouncer who controls who enters and exits the club because the cell membrane controls what is able to permeate into the cell. It’s good, but I like to think of it as a door.

You might be interested in
CELL DIVISION QUESTION HELPP PLEASE!!!!!!!1
ser-zykov [4K]

Answer:

b

Explanation:

3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
PLZ HELP WILL GIVE BRAINLY Analyze environmental disturbances, such as climate changes, natural events, human activity and the i
Dvinal [7]

Answer:

All of these environmental disturbances use such energy present within the ecosystem to survive and reproduce. In order to conserve the health of the environment, the best thing that can be done is finding ways to reuse the energy as much as we can such as recycling cardboards or tin cans. Other ways would be to lower use of carbon emitting cars and have more conservation awareness.

7 0
4 years ago
How do water and sunlight affect decomposers ?
Dovator [93]

Answer:

As the volume of available water increases, the rate of decomposition also increases. Many decomposers secrete enzymes onto decaying matter and then absorb any dissolved molecules and sunlight allows things to grow out of decomposers allowing faster decomposition from the plant absorbing the other nutrients from the things in the decomposer making the soil rich and fertile.

5 0
3 years ago
Based on the arrows, what does the image represent?
Karolina [17]

Answer:

I think the answer is B i might be mistaken though c:

Explanation:

4 0
4 years ago
Other questions:
  • Which represents a negative impact of technology?
    7·1 answer
  • What is a major difference between facilitated diffusion and active transport?
    11·1 answer
  • An individual’s behavior characteristics, emotional expression, and intensity that is established from birth is known as _______
    8·2 answers
  • All of the following are macromolecules except:
    14·1 answer
  • The backbone of DNA and RNA is composed of?
    12·2 answers
  • Briefly explain how the geologist Charles Lyell influenced Darwin’s ideas about how evolution works
    10·1 answer
  • a biologist identifies an organism that lives in the gills of a fish and consumes the fishs blood. what type of relationship do
    8·1 answer
  • Which of the following is true about science and technology?
    6·1 answer
  • Which cell type is produced by mitosis?<br><br> A) haploid<br> B) diploid<br> C) sperm<br> D) gamete
    11·1 answer
  • Pepsin, a digestive enzyme that degrades proteins in the stomach, is synthesized as pepsinogen and converted to active pepsin in
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!