1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Novosadov [1.4K]
3 years ago
15

What is a primary function of charts graphs and illustrations in a procedural document?

Biology
2 answers:
Arlecino [84]3 years ago
4 0
<span>To provide a great deal of information at a glance</span>
jonny [76]3 years ago
3 0
Provide a great deal of information at a glance
You might be interested in
Which conditions are common to all three of the following: genetic drift, the founder principle, and the bottleneck effect? a. i
Tcecarenko [31]

Explanation:

Common to genetic drift, the founder principle, and the bottleneck effect:

b. in small populations and result in a decrease in genetic diversity and/or an increase in the occurrence of specific genetic traits

c. when a small group of organisms only reproduce with each other to create a larger population of organisms

d. when the majority of a population is killed off and there are only a few remaining organisms left to rebuild the population

Further Explanation:

During the process of cell division, spontaneous changes within the genome can arise, called mutations. These are errors occur when copies of the DNA within the cell are made; mutations may range from small changes called single nucleotide polymorphisms, to large scale deletions, and additions which span multiple genes.

These mutations form variants which become stable within a population, leading to the formation of separate, genetically distinct populations called species.

  • mutations accumulate in a population over time, altering the frequency of alleles or different forms of a gene- this is called genetic drift.
  • In the founder effect, the separation of a group from a larger group can decrease genetic diversity, this can create a genetically distinct population
  • In the bottleneck effect, a population die off or barrier to reproduction increases the genetic drift in the population

Learn more about mutations at brainly.com/question/4602376

Learn more about DNA and RNA at brainly.com/question/2416343?source=aid8411316

#LearnWithBrainly

5 0
3 years ago
Read 2 more answers
In cell signaling how is the flow of ions regulated
anzhelika [568]
The opening and closing of ligan-gated ion channels
6 0
3 years ago
Which of the following molecular movements is due to diffusion or osmosis? a) The sodium-potassium pump pumps three sodium ions
MrMuchimi

Answer:

The correct answer is  b) When a plant cell is placed in concentrated salt water, water moves out of the cell.

Explanation:

Osmosis is the movement of solvent molecules from an area of less concentration of solute to high concentration of solute to equalize the concentration of both the side of the cell.

So water will move outside the cell when any cell will be placed in a concentrated salt water because the concentration of solute is high in salt water and low inside the cell.

Therefore when a plant cell is placed in salt water the osmosis of water takes place from inside to outside the cell. So the right answer is b.

6 0
3 years ago
Sickle cell disease is caused by _____ misfolding.
andrew-mc [135]

Answer:

red blood cells (RBCs) misfolding and convert in sickle shapevfrom the donut with out hole shape.

3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • An atom of the element ____________has an average atomic mass of about 16 amu.
    12·2 answers
  • Which question most closely relates to the forester's observations and the collected scientific data on forests
    13·1 answer
  • _________ is the method used to support a likely sequence of events at a crime scene by the observation and evaluation of physic
    12·2 answers
  • In which type of climate does chemical weathering usually occur most rapidly?
    14·2 answers
  • What happens when electrons are passed doe the electron transport chain
    6·1 answer
  • Upon looking at a sample of lake water, Joey noticed that each organism he saw was unicellular and had a nucleus. Some had chlor
    13·2 answers
  • Will make brainliest if you subscribe to janathion loran https://screenshare.host/B7N8NT
    12·1 answer
  • Can someone help me out with this one, if you do ill give you brainly and give extra points! Thank you :) I’m giving 100 points
    10·2 answers
  • A viral outbreak in a city needs to be traced to its source. How can wastewater be used to trace the viral outbreak?
    13·2 answers
  • What is a sequence of dna nucleotides that holds the instructions to make a protein?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!